Incidental Mutation 'R4983:Map3k20'
ID385687
Institutional Source Beutler Lab
Gene Symbol Map3k20
Ensembl Gene ENSMUSG00000004085
Gene Namemitogen-activated protein kinase kinase kinase 20
SynonymsMLTKalpha, Zak, MLTKbeta, B230120H23Rik
MMRRC Submission 042577-MU
Accession Numbers

Genbank: NM_023057, NM_178084; MGI: 2443258

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4983 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location72285637-72442610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72402067 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 356 (M356V)
Ref Sequence ENSEMBL: ENSMUSP00000118983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090824] [ENSMUST00000135469]
Predicted Effect probably benign
Transcript: ENSMUST00000090824
SMART Domains Protein: ENSMUSP00000088334
Gene: ENSMUSG00000004085

DomainStartEndE-ValueType
Pfam:Pkinase 16 259 6.3e-56 PFAM
Pfam:Pkinase_Tyr 16 260 9.9e-64 PFAM
coiled coil region 277 328 N/A INTRINSIC
SAM 336 410 5.59e-7 SMART
low complexity region 643 668 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112073
Predicted Effect probably benign
Transcript: ENSMUST00000135469
AA Change: M356V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000118983
Gene: ENSMUSG00000004085
AA Change: M356V

DomainStartEndE-ValueType
Pfam:Pkinase 16 259 1.1e-59 PFAM
Pfam:Pkinase_Tyr 16 260 7.6e-65 PFAM
coiled coil region 277 328 N/A INTRINSIC
low complexity region 428 452 N/A INTRINSIC
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (103/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MAPKKK family of signal transduction molecules and encodes a protein with an N-terminal kinase catalytic domain, followed by a leucine zipper motif and a sterile-alpha motif (SAM). This magnesium-binding protein forms homodimers and is located in the cytoplasm. The protein mediates gamma radiation signaling leading to cell cycle arrest and activity of this protein plays a role in cell cycle checkpoint regulation in cells. The protein also has pro-apoptotic activity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality at E9.5 with growth retardation. Mice homozygous for an allele lacking the SAM domain exhibit low penetrant unilateral complex hindlimb duplication phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik T G 19: 42,053,076 S215R possibly damaging Het
9130011E15Rik T C 19: 45,950,707 T335A probably benign Het
Abcc9 T C 6: 142,682,141 M388V probably benign Het
Acbd6 A C 1: 155,601,529 T154P probably benign Het
Ago1 T C 4: 126,453,654 D434G probably damaging Het
Ankib1 A T 5: 3,769,652 M89K probably benign Het
Arap2 A T 5: 62,676,525 H866Q probably damaging Het
BC017158 C T 7: 128,276,473 probably benign Het
Capn12 A T 7: 28,890,370 H622L probably benign Het
Capns2 T G 8: 92,901,902 F140V probably damaging Het
Catsper1 T G 19: 5,335,963 F75V probably benign Het
Ccdc24 T C 4: 117,872,100 N16S probably benign Het
Cdkn2aip A T 8: 47,712,929 L114Q probably damaging Het
Cenpe T A 3: 135,234,928 S649R probably damaging Het
Chgb A T 2: 132,793,682 R515W probably damaging Het
Chrnb1 A G 11: 69,793,978 F123S probably damaging Het
Copz2 A T 11: 96,857,551 probably null Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Daw1 C A 1: 83,187,998 A178E probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epb41l5 T C 1: 119,555,071 D629G probably benign Het
Erap1 A G 13: 74,690,710 E925G probably benign Het
Exoc7 A C 11: 116,289,269 F657V probably damaging Het
Fam210b G C 2: 172,345,665 A2P probably damaging Homo
Fry A G 5: 150,398,254 E1018G probably damaging Het
Galc A T 12: 98,242,768 L15* probably null Het
Gm11232 T A 4: 71,756,901 K121N possibly damaging Het
Gm17677 T G 9: 35,742,169 F90V probably benign Het
Hectd1 A T 12: 51,784,262 D931E probably benign Het
Hecw2 T C 1: 53,832,671 H1372R probably benign Het
Ighv3-2 T A 12: 114,033,986 noncoding transcript Het
Kcns2 T G 15: 34,839,605 S371R probably damaging Het
Kif23 T C 9: 61,936,703 K175E probably benign Het
Kmt2c G A 5: 25,295,511 R436W possibly damaging Het
Lama5 A G 2: 180,193,449 S1317P probably benign Het
Lce1e T C 3: 92,707,828 S71G unknown Het
Lrrc37a T A 11: 103,497,618 E2327V unknown Het
Med12l C T 3: 59,261,929 A1580V probably damaging Het
Metap2 G T 10: 93,889,600 T30K possibly damaging Het
Mysm1 T A 4: 94,972,970 T53S probably benign Het
Nasp A T 4: 116,602,185 D717E probably damaging Het
Ndnf G A 6: 65,703,571 R278H possibly damaging Het
Neb A T 2: 52,216,261 N4205K probably damaging Het
Nebl A T 2: 17,375,271 I764N possibly damaging Het
Nucb1 A G 7: 45,498,889 Y131H probably damaging Het
Olfr1157 G T 2: 87,962,698 H65N probably benign Het
Olfr292 A C 7: 86,694,479 T8P probably benign Het
Olfr381 A G 11: 73,486,797 I9T probably benign Het
Oscp1 T A 4: 126,076,762 C115S probably benign Het
Paip2 C T 18: 35,613,359 R59C possibly damaging Het
Pcdhga4 G A 18: 37,686,519 D374N probably damaging Het
Pcolce G T 5: 137,605,674 probably benign Het
Pcyox1l T C 18: 61,699,397 E193G probably damaging Het
Pde6b A T 5: 108,425,330 Q522L probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phf11a A G 14: 59,284,438 F95L probably benign Het
Pja2 A C 17: 64,309,058 S281A probably benign Het
Plekhm2 A G 4: 141,634,376 F272S probably damaging Het
Pom121l2 T C 13: 21,983,814 S752P probably benign Het
Ppl T C 16: 5,088,718 T1238A possibly damaging Het
Prmt7 A G 8: 106,250,363 Y569C probably damaging Het
Prss37 G A 6: 40,516,136 T132I probably benign Het
Psmf1 A T 2: 151,729,457 probably benign Het
Ptprj A C 2: 90,460,532 I528S probably damaging Het
Reg1 A G 6: 78,428,213 T140A possibly damaging Het
Rtn4 A G 11: 29,707,217 N457S probably benign Het
Scn9a T C 2: 66,566,270 K93R probably benign Het
Sec16a A G 2: 26,439,519 V828A probably benign Het
Sec23b T A 2: 144,581,953 D507E probably benign Het
Sirt4 A T 5: 115,482,791 F107L probably benign Het
Slc14a2 A T 18: 78,150,401 L862Q probably damaging Het
Slc16a4 T C 3: 107,300,860 S229P probably benign Het
Slc37a3 A T 6: 39,352,717 C185* probably null Het
Slc5a2 A T 7: 128,271,810 *154C probably null Het
Snx17 A G 5: 31,195,794 S42G possibly damaging Het
Tgm6 T C 2: 130,141,193 V234A probably damaging Het
Thbs4 A G 13: 92,790,699 M94T probably benign Het
Thtpa A G 14: 55,072,148 probably benign Het
Tie1 T C 4: 118,483,755 E343G probably damaging Het
Tmem145 A G 7: 25,308,602 I238V probably benign Het
Tmprss11f T C 5: 86,537,999 S170G probably benign Het
Tnk2 T A 16: 32,680,465 D865E probably damaging Het
Ttll8 T C 15: 88,925,582 E337G probably benign Het
Ttn G A 2: 76,867,446 probably benign Het
Tubgcp6 T C 15: 89,106,291 E710G probably damaging Het
Txndc2 T A 17: 65,638,060 H374L probably benign Het
Unc80 G T 1: 66,674,732 probably null Het
Vmn2r23 G A 6: 123,733,349 C537Y probably damaging Het
Vmn2r45 A G 7: 8,483,117 F391L probably damaging Het
Vstm4 A T 14: 32,919,245 T262S probably benign Het
Zfp180 C T 7: 24,106,078 R641C probably damaging Het
Zfp979 A T 4: 147,613,914 S113T possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Zswim5 T A 4: 116,985,686 M876K possibly damaging Het
Other mutations in Map3k20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Map3k20 APN 2 72412170 missense probably damaging 1.00
IGL00333:Map3k20 APN 2 72371976 missense probably damaging 0.99
IGL00505:Map3k20 APN 2 72389483 missense probably damaging 1.00
IGL01472:Map3k20 APN 2 72355553 splice site probably benign
IGL01982:Map3k20 APN 2 72298333 nonsense probably null
IGL02556:Map3k20 APN 2 72371895 missense probably damaging 0.98
IGL02831:Map3k20 APN 2 72371727 missense probably damaging 1.00
3-1:Map3k20 UTSW 2 72412125 missense probably damaging 1.00
R0765:Map3k20 UTSW 2 72371925 missense probably damaging 1.00
R1160:Map3k20 UTSW 2 72441520 missense probably benign 0.01
R1195:Map3k20 UTSW 2 72438218 missense probably damaging 1.00
R1195:Map3k20 UTSW 2 72438218 missense probably damaging 1.00
R1195:Map3k20 UTSW 2 72438218 missense probably damaging 1.00
R1406:Map3k20 UTSW 2 72389494 missense probably damaging 0.99
R1406:Map3k20 UTSW 2 72389494 missense probably damaging 0.99
R1509:Map3k20 UTSW 2 72364624 splice site probably benign
R1634:Map3k20 UTSW 2 72410177 nonsense probably null
R1723:Map3k20 UTSW 2 72389492 missense probably damaging 1.00
R1986:Map3k20 UTSW 2 72441294 nonsense probably null
R2014:Map3k20 UTSW 2 72438260 missense probably benign 0.00
R2086:Map3k20 UTSW 2 72398385 missense probably benign 0.01
R2311:Map3k20 UTSW 2 72368440 missense probably damaging 1.00
R2655:Map3k20 UTSW 2 72433420 missense probably damaging 1.00
R3150:Map3k20 UTSW 2 72371992 missense probably damaging 1.00
R3781:Map3k20 UTSW 2 72402355 intron probably benign
R3950:Map3k20 UTSW 2 72438300 missense probably damaging 0.99
R3951:Map3k20 UTSW 2 72438300 missense probably damaging 0.99
R3952:Map3k20 UTSW 2 72438300 missense probably damaging 0.99
R3981:Map3k20 UTSW 2 72438227 missense probably damaging 0.99
R3982:Map3k20 UTSW 2 72438227 missense probably damaging 0.99
R3983:Map3k20 UTSW 2 72438227 missense probably damaging 0.99
R4011:Map3k20 UTSW 2 72384124 splice site probably benign
R4180:Map3k20 UTSW 2 72441571 missense probably damaging 0.97
R4790:Map3k20 UTSW 2 72441704 missense probably benign
R4895:Map3k20 UTSW 2 72402356 intron probably benign
R4943:Map3k20 UTSW 2 72371918 missense possibly damaging 0.90
R5023:Map3k20 UTSW 2 72402345 intron probably benign
R5157:Map3k20 UTSW 2 72438214 missense probably benign 0.00
R5703:Map3k20 UTSW 2 72402170 missense probably benign 0.00
R6134:Map3k20 UTSW 2 72410159 missense probably damaging 0.99
R6322:Map3k20 UTSW 2 72433470 missense possibly damaging 0.95
R6418:Map3k20 UTSW 2 72402113 missense probably benign 0.15
R6449:Map3k20 UTSW 2 72398414 missense probably damaging 1.00
R6495:Map3k20 UTSW 2 72368419 missense probably damaging 1.00
R6508:Map3k20 UTSW 2 72441909 missense probably benign 0.08
R7016:Map3k20 UTSW 2 72378635 missense probably damaging 1.00
R7173:Map3k20 UTSW 2 72441414 missense probably benign 0.06
R7319:Map3k20 UTSW 2 72364718 missense probably damaging 1.00
R7635:Map3k20 UTSW 2 72402004 missense probably benign 0.12
R7641:Map3k20 UTSW 2 72398361 missense probably damaging 1.00
R7698:Map3k20 UTSW 2 72364681 nonsense probably null
R7698:Map3k20 UTSW 2 72438314 missense probably benign 0.16
R7872:Map3k20 UTSW 2 72371754 missense probably damaging 0.97
R7955:Map3k20 UTSW 2 72371754 missense probably damaging 0.97
R8008:Map3k20 UTSW 2 72438269 missense probably benign 0.16
Z1177:Map3k20 UTSW 2 72298315 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATTCACCTGCTGCGTGGTAC -3'
(R):5'- TCTGACAGGTCAAAGTCACTG -3'

Sequencing Primer
(F):5'- CTGCGTGGTACCAACTAATTTTG -3'
(R):5'- CCAGGGCCATGTTGACTTTC -3'
Posted On2016-05-10