Incidental Mutation 'R4983:Nasp'
ID385706
Institutional Source Beutler Lab
Gene Symbol Nasp
Ensembl Gene ENSMUSG00000028693
Gene Namenuclear autoantigenic sperm protein (histone-binding)
SynonymsD4Ertd767e, 5033430J04Rik, Epcs32, Nasp-T
MMRRC Submission 042577-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4983 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location116601052-116627941 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116602185 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 717 (D717E)
Ref Sequence ENSEMBL: ENSMUSP00000030456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030456] [ENSMUST00000030457] [ENSMUST00000051869] [ENSMUST00000081182]
Predicted Effect probably damaging
Transcript: ENSMUST00000030456
AA Change: D717E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030456
Gene: ENSMUSG00000028693
AA Change: D717E

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 8.51e0 SMART
low complexity region 111 126 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
low complexity region 336 352 N/A INTRINSIC
low complexity region 455 478 N/A INTRINSIC
low complexity region 492 503 N/A INTRINSIC
TPR 528 561 3.05e0 SMART
TPR 570 603 2.38e-2 SMART
low complexity region 620 640 N/A INTRINSIC
low complexity region 703 715 N/A INTRINSIC
low complexity region 742 759 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000030457
AA Change: D392E

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000030457
Gene: ENSMUSG00000028693
AA Change: D392E

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 8.51e0 SMART
low complexity region 111 126 N/A INTRINSIC
low complexity region 133 153 N/A INTRINSIC
low complexity region 167 178 N/A INTRINSIC
TPR 203 236 3.05e0 SMART
TPR 245 278 2.38e-2 SMART
low complexity region 295 315 N/A INTRINSIC
low complexity region 378 390 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051869
SMART Domains Protein: ENSMUSP00000059848
Gene: ENSMUSG00000034035

DomainStartEndE-ValueType
coiled coil region 97 161 N/A INTRINSIC
coiled coil region 219 270 N/A INTRINSIC
low complexity region 415 427 N/A INTRINSIC
low complexity region 523 537 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081182
AA Change: D365E

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000079946
Gene: ENSMUSG00000028693
AA Change: D365E

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 6.2e-2 SMART
low complexity region 84 99 N/A INTRINSIC
low complexity region 106 126 N/A INTRINSIC
low complexity region 140 151 N/A INTRINSIC
TPR 176 209 1.4e-2 SMART
TPR 218 251 1.1e-4 SMART
low complexity region 268 288 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
low complexity region 390 407 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151441
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155398
Meta Mutation Damage Score 0.0663 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (103/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a H1 histone binding protein that is involved in transporting histones into the nucleus of dividing cells. Multiple isoforms are encoded by transcript variants of this gene. The somatic form is expressed in all mitotic cells, is localized to the nucleus, and is coupled to the cell cycle. The testicular form is expressed in embryonic tissues, tumor cells, and the testis. In male germ cells, this protein is localized to the cytoplasm of primary spermatocytes, the nucleus of spermatids, and the periacrosomal region of mature spermatozoa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik T G 19: 42,053,076 S215R possibly damaging Het
9130011E15Rik T C 19: 45,950,707 T335A probably benign Het
Abcc9 T C 6: 142,682,141 M388V probably benign Het
Acbd6 A C 1: 155,601,529 T154P probably benign Het
Ago1 T C 4: 126,453,654 D434G probably damaging Het
Ankib1 A T 5: 3,769,652 M89K probably benign Het
Arap2 A T 5: 62,676,525 H866Q probably damaging Het
BC017158 C T 7: 128,276,473 probably benign Het
Capn12 A T 7: 28,890,370 H622L probably benign Het
Capns2 T G 8: 92,901,902 F140V probably damaging Het
Catsper1 T G 19: 5,335,963 F75V probably benign Het
Ccdc24 T C 4: 117,872,100 N16S probably benign Het
Cdkn2aip A T 8: 47,712,929 L114Q probably damaging Het
Cenpe T A 3: 135,234,928 S649R probably damaging Het
Chgb A T 2: 132,793,682 R515W probably damaging Het
Chrnb1 A G 11: 69,793,978 F123S probably damaging Het
Copz2 A T 11: 96,857,551 probably null Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Daw1 C A 1: 83,187,998 A178E probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epb41l5 T C 1: 119,555,071 D629G probably benign Het
Erap1 A G 13: 74,690,710 E925G probably benign Het
Exoc7 A C 11: 116,289,269 F657V probably damaging Het
Fam210b G C 2: 172,345,665 A2P probably damaging Homo
Fry A G 5: 150,398,254 E1018G probably damaging Het
Galc A T 12: 98,242,768 L15* probably null Het
Gm11232 T A 4: 71,756,901 K121N possibly damaging Het
Gm17677 T G 9: 35,742,169 F90V probably benign Het
Hectd1 A T 12: 51,784,262 D931E probably benign Het
Hecw2 T C 1: 53,832,671 H1372R probably benign Het
Ighv3-2 T A 12: 114,033,986 noncoding transcript Het
Kcns2 T G 15: 34,839,605 S371R probably damaging Het
Kif23 T C 9: 61,936,703 K175E probably benign Het
Kmt2c G A 5: 25,295,511 R436W possibly damaging Het
Lama5 A G 2: 180,193,449 S1317P probably benign Het
Lce1e T C 3: 92,707,828 S71G unknown Het
Lrrc37a T A 11: 103,497,618 E2327V unknown Het
Map3k20 A G 2: 72,402,067 M356V probably benign Het
Med12l C T 3: 59,261,929 A1580V probably damaging Het
Metap2 G T 10: 93,889,600 T30K possibly damaging Het
Mysm1 T A 4: 94,972,970 T53S probably benign Het
Ndnf G A 6: 65,703,571 R278H possibly damaging Het
Neb A T 2: 52,216,261 N4205K probably damaging Het
Nebl A T 2: 17,375,271 I764N possibly damaging Het
Nucb1 A G 7: 45,498,889 Y131H probably damaging Het
Olfr1157 G T 2: 87,962,698 H65N probably benign Het
Olfr292 A C 7: 86,694,479 T8P probably benign Het
Olfr381 A G 11: 73,486,797 I9T probably benign Het
Oscp1 T A 4: 126,076,762 C115S probably benign Het
Paip2 C T 18: 35,613,359 R59C possibly damaging Het
Pcdhga4 G A 18: 37,686,519 D374N probably damaging Het
Pcolce G T 5: 137,605,674 probably benign Het
Pcyox1l T C 18: 61,699,397 E193G probably damaging Het
Pde6b A T 5: 108,425,330 Q522L probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phf11a A G 14: 59,284,438 F95L probably benign Het
Pja2 A C 17: 64,309,058 S281A probably benign Het
Plekhm2 A G 4: 141,634,376 F272S probably damaging Het
Pom121l2 T C 13: 21,983,814 S752P probably benign Het
Ppl T C 16: 5,088,718 T1238A possibly damaging Het
Prmt7 A G 8: 106,250,363 Y569C probably damaging Het
Prss37 G A 6: 40,516,136 T132I probably benign Het
Psmf1 A T 2: 151,729,457 probably benign Het
Ptprj A C 2: 90,460,532 I528S probably damaging Het
Reg1 A G 6: 78,428,213 T140A possibly damaging Het
Rtn4 A G 11: 29,707,217 N457S probably benign Het
Scn9a T C 2: 66,566,270 K93R probably benign Het
Sec16a A G 2: 26,439,519 V828A probably benign Het
Sec23b T A 2: 144,581,953 D507E probably benign Het
Sirt4 A T 5: 115,482,791 F107L probably benign Het
Slc14a2 A T 18: 78,150,401 L862Q probably damaging Het
Slc16a4 T C 3: 107,300,860 S229P probably benign Het
Slc37a3 A T 6: 39,352,717 C185* probably null Het
Slc5a2 A T 7: 128,271,810 *154C probably null Het
Snx17 A G 5: 31,195,794 S42G possibly damaging Het
Tgm6 T C 2: 130,141,193 V234A probably damaging Het
Thbs4 A G 13: 92,790,699 M94T probably benign Het
Thtpa A G 14: 55,072,148 probably benign Het
Tie1 T C 4: 118,483,755 E343G probably damaging Het
Tmem145 A G 7: 25,308,602 I238V probably benign Het
Tmprss11f T C 5: 86,537,999 S170G probably benign Het
Tnk2 T A 16: 32,680,465 D865E probably damaging Het
Ttll8 T C 15: 88,925,582 E337G probably benign Het
Ttn G A 2: 76,867,446 probably benign Het
Tubgcp6 T C 15: 89,106,291 E710G probably damaging Het
Txndc2 T A 17: 65,638,060 H374L probably benign Het
Unc80 G T 1: 66,674,732 probably null Het
Vmn2r23 G A 6: 123,733,349 C537Y probably damaging Het
Vmn2r45 A G 7: 8,483,117 F391L probably damaging Het
Vstm4 A T 14: 32,919,245 T262S probably benign Het
Zfp180 C T 7: 24,106,078 R641C probably damaging Het
Zfp979 A T 4: 147,613,914 S113T possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Zswim5 T A 4: 116,985,686 M876K possibly damaging Het
Other mutations in Nasp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Nasp APN 4 116604219 missense probably damaging 1.00
IGL00780:Nasp APN 4 116603999 nonsense probably null
IGL00833:Nasp APN 4 116602736 missense probably damaging 1.00
IGL02232:Nasp APN 4 116604800 missense probably damaging 0.99
R0023:Nasp UTSW 4 116605771 splice site probably benign
R0023:Nasp UTSW 4 116605771 splice site probably benign
R0179:Nasp UTSW 4 116602157 missense probably damaging 1.00
R0385:Nasp UTSW 4 116610695 missense probably benign 0.02
R1707:Nasp UTSW 4 116618936 missense probably damaging 0.99
R1945:Nasp UTSW 4 116622768 missense possibly damaging 0.62
R2061:Nasp UTSW 4 116611126 missense probably benign 0.12
R5064:Nasp UTSW 4 116611970 critical splice donor site probably null
R5687:Nasp UTSW 4 116605805 intron probably benign
R5713:Nasp UTSW 4 116614361 missense probably benign 0.34
R5839:Nasp UTSW 4 116602091 critical splice donor site probably null
R6145:Nasp UTSW 4 116611077 missense probably benign 0.19
R6159:Nasp UTSW 4 116603889 splice site probably null
R6234:Nasp UTSW 4 116622782 missense possibly damaging 0.51
R6286:Nasp UTSW 4 116604788 missense probably damaging 1.00
R6483:Nasp UTSW 4 116618948 missense probably damaging 1.00
R6899:Nasp UTSW 4 116604333 missense probably damaging 1.00
R7276:Nasp UTSW 4 116614349 missense probably damaging 1.00
R7412:Nasp UTSW 4 116610588 missense possibly damaging 0.85
R7763:Nasp UTSW 4 116612033 missense probably benign 0.03
R8166:Nasp UTSW 4 116610915 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TTCACATAGACACTTGAGAGGC -3'
(R):5'- GTTCCATGTGCCTCAACAATGTC -3'

Sequencing Primer
(F):5'- CATAGACACTTGAGAGGCCTGGC -3'
(R):5'- CATCATCTATGTTGTGGTCAGC -3'
Posted On2016-05-10