Incidental Mutation 'R4983:Zfp979'
ID 385713
Institutional Source Beutler Lab
Gene Symbol Zfp979
Ensembl Gene ENSMUSG00000066000
Gene Name zinc finger protein 979
Synonyms Ssm1, 2610305D13Rik
MMRRC Submission 042577-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R4983 (G1)
Quality Score 120
Status Validated
Chromosome 4
Chromosomal Location 147696394-147726970 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 147698371 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 113 (S113T)
Ref Sequence ENSEMBL: ENSMUSP00000114677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037565] [ENSMUST00000105720] [ENSMUST00000133006]
AlphaFold A2A799
Predicted Effect possibly damaging
Transcript: ENSMUST00000037565
AA Change: S113T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038153
Gene: ENSMUSG00000066000
AA Change: S113T

DomainStartEndE-ValueType
KRAB 28 88 2.06e-16 SMART
ZnF_C2H2 257 279 2.06e1 SMART
ZnF_C2H2 285 307 2.53e-2 SMART
ZnF_C2H2 313 335 1.95e-3 SMART
ZnF_C2H2 341 363 1.4e1 SMART
ZnF_C2H2 369 391 9.08e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105720
AA Change: S113T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101345
Gene: ENSMUSG00000066000
AA Change: S113T

DomainStartEndE-ValueType
KRAB 28 88 2.06e-16 SMART
ZnF_C2H2 257 279 2.06e1 SMART
ZnF_C2H2 285 307 2.53e-2 SMART
ZnF_C2H2 313 335 1.95e-3 SMART
ZnF_C2H2 341 363 1.4e1 SMART
ZnF_C2H2 369 391 9.08e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000133006
AA Change: S113T

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114677
Gene: ENSMUSG00000066000
AA Change: S113T

DomainStartEndE-ValueType
KRAB 28 88 2.06e-16 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (103/106)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik T G 19: 42,041,515 (GRCm39) S215R possibly damaging Het
Abcc9 T C 6: 142,627,867 (GRCm39) M388V probably benign Het
Acbd6 A C 1: 155,477,275 (GRCm39) T154P probably benign Het
Ago1 T C 4: 126,347,447 (GRCm39) D434G probably damaging Het
Ankib1 A T 5: 3,819,652 (GRCm39) M89K probably benign Het
Arap2 A T 5: 62,833,868 (GRCm39) H866Q probably damaging Het
Armh3 T C 19: 45,939,146 (GRCm39) T335A probably benign Het
Capn12 A T 7: 28,589,795 (GRCm39) H622L probably benign Het
Capns2 T G 8: 93,628,530 (GRCm39) F140V probably damaging Het
Catsper1 T G 19: 5,385,991 (GRCm39) F75V probably benign Het
Ccdc24 T C 4: 117,729,297 (GRCm39) N16S probably benign Het
Cdkn2aip A T 8: 48,165,964 (GRCm39) L114Q probably damaging Het
Cenpe T A 3: 134,940,689 (GRCm39) S649R probably damaging Het
Chgb A T 2: 132,635,602 (GRCm39) R515W probably damaging Het
Chrnb1 A G 11: 69,684,804 (GRCm39) F123S probably damaging Het
Copz2 A T 11: 96,748,377 (GRCm39) probably null Het
Cspp1 T A 1: 10,196,688 (GRCm39) N900K probably damaging Het
Daw1 C A 1: 83,165,719 (GRCm39) A178E probably benign Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Epb41l5 T C 1: 119,482,801 (GRCm39) D629G probably benign Het
Erap1 A G 13: 74,838,829 (GRCm39) E925G probably benign Het
Exoc7 A C 11: 116,180,095 (GRCm39) F657V probably damaging Het
Fam210b G C 2: 172,187,585 (GRCm39) A2P probably damaging Homo
Fry A G 5: 150,321,719 (GRCm39) E1018G probably damaging Het
Galc A T 12: 98,209,027 (GRCm39) L15* probably null Het
Gm11232 T A 4: 71,675,138 (GRCm39) K121N possibly damaging Het
Hectd1 A T 12: 51,831,045 (GRCm39) D931E probably benign Het
Hecw2 T C 1: 53,871,830 (GRCm39) H1372R probably benign Het
Ighv3-2 T A 12: 113,997,606 (GRCm39) noncoding transcript Het
Kcns2 T G 15: 34,839,751 (GRCm39) S371R probably damaging Het
Kif23 T C 9: 61,843,985 (GRCm39) K175E probably benign Het
Kmt2c G A 5: 25,500,509 (GRCm39) R436W possibly damaging Het
Lama5 A G 2: 179,835,242 (GRCm39) S1317P probably benign Het
Lce1e T C 3: 92,615,135 (GRCm39) S71G unknown Het
Lrrc37a T A 11: 103,388,444 (GRCm39) E2327V unknown Het
Map3k20 A G 2: 72,232,411 (GRCm39) M356V probably benign Het
Med12l C T 3: 59,169,350 (GRCm39) A1580V probably damaging Het
Metap2 G T 10: 93,725,462 (GRCm39) T30K possibly damaging Het
Mysm1 T A 4: 94,861,207 (GRCm39) T53S probably benign Het
Nasp A T 4: 116,459,382 (GRCm39) D717E probably damaging Het
Ndnf G A 6: 65,680,555 (GRCm39) R278H possibly damaging Het
Neb A T 2: 52,106,273 (GRCm39) N4205K probably damaging Het
Nebl A T 2: 17,380,082 (GRCm39) I764N possibly damaging Het
Nucb1 A G 7: 45,148,313 (GRCm39) Y131H probably damaging Het
Or14c39 A C 7: 86,343,687 (GRCm39) T8P probably benign Het
Or1e22 A G 11: 73,377,623 (GRCm39) I9T probably benign Het
Or5l14 G T 2: 87,793,042 (GRCm39) H65N probably benign Het
Oscp1 T A 4: 125,970,555 (GRCm39) C115S probably benign Het
Paip2 C T 18: 35,746,412 (GRCm39) R59C possibly damaging Het
Pate10 T G 9: 35,653,465 (GRCm39) F90V probably benign Het
Pcdhga4 G A 18: 37,819,572 (GRCm39) D374N probably damaging Het
Pcolce G T 5: 137,603,936 (GRCm39) probably benign Het
Pcyox1l T C 18: 61,832,468 (GRCm39) E193G probably damaging Het
Pde6b A T 5: 108,573,196 (GRCm39) Q522L probably benign Het
Peg10 T TCCG 6: 4,756,451 (GRCm39) probably benign Het
Phf11a A G 14: 59,521,887 (GRCm39) F95L probably benign Het
Pja2 A C 17: 64,616,053 (GRCm39) S281A probably benign Het
Plekhm2 A G 4: 141,361,687 (GRCm39) F272S probably damaging Het
Pom121l2 T C 13: 22,167,984 (GRCm39) S752P probably benign Het
Ppl T C 16: 4,906,582 (GRCm39) T1238A possibly damaging Het
Prmt7 A G 8: 106,976,995 (GRCm39) Y569C probably damaging Het
Prss37 G A 6: 40,493,070 (GRCm39) T132I probably benign Het
Psmf1 A T 2: 151,571,377 (GRCm39) probably benign Het
Ptprj A C 2: 90,290,876 (GRCm39) I528S probably damaging Het
Reg1 A G 6: 78,405,196 (GRCm39) T140A possibly damaging Het
Rtn4 A G 11: 29,657,217 (GRCm39) N457S probably benign Het
Rusf1 C T 7: 127,875,645 (GRCm39) probably benign Het
Scn9a T C 2: 66,396,614 (GRCm39) K93R probably benign Het
Sec16a A G 2: 26,329,531 (GRCm39) V828A probably benign Het
Sec23b T A 2: 144,423,873 (GRCm39) D507E probably benign Het
Sirt4 A T 5: 115,620,850 (GRCm39) F107L probably benign Het
Slc14a2 A T 18: 78,193,616 (GRCm39) L862Q probably damaging Het
Slc16a4 T C 3: 107,208,176 (GRCm39) S229P probably benign Het
Slc37a3 A T 6: 39,329,651 (GRCm39) C185* probably null Het
Slc5a2 A T 7: 127,870,982 (GRCm39) *154C probably null Het
Snx17 A G 5: 31,353,138 (GRCm39) S42G possibly damaging Het
Tgm6 T C 2: 129,983,113 (GRCm39) V234A probably damaging Het
Thbs4 A G 13: 92,927,207 (GRCm39) M94T probably benign Het
Thtpa A G 14: 55,309,605 (GRCm39) probably benign Het
Tie1 T C 4: 118,340,952 (GRCm39) E343G probably damaging Het
Tmem145 A G 7: 25,008,027 (GRCm39) I238V probably benign Het
Tmprss11f T C 5: 86,685,858 (GRCm39) S170G probably benign Het
Tnk2 T A 16: 32,499,283 (GRCm39) D865E probably damaging Het
Ttll8 T C 15: 88,809,785 (GRCm39) E337G probably benign Het
Ttn G A 2: 76,697,790 (GRCm39) probably benign Het
Tubgcp6 T C 15: 88,990,494 (GRCm39) E710G probably damaging Het
Txndc2 T A 17: 65,945,055 (GRCm39) H374L probably benign Het
Unc80 G T 1: 66,713,891 (GRCm39) probably null Het
Vmn2r23 G A 6: 123,710,308 (GRCm39) C537Y probably damaging Het
Vmn2r45 A G 7: 8,486,116 (GRCm39) F391L probably damaging Het
Vstm4 A T 14: 32,641,202 (GRCm39) T262S probably benign Het
Zfp180 C T 7: 23,805,503 (GRCm39) R641C probably damaging Het
Zswim4 C T 8: 84,953,296 (GRCm39) probably null Het
Zswim5 T A 4: 116,842,883 (GRCm39) M876K possibly damaging Het
Other mutations in Zfp979
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Zfp979 APN 4 147,699,853 (GRCm39) missense probably damaging 0.98
IGL01865:Zfp979 APN 4 147,699,774 (GRCm39) missense probably benign 0.03
IGL02336:Zfp979 APN 4 147,699,808 (GRCm39) missense probably damaging 1.00
R0336:Zfp979 UTSW 4 147,697,592 (GRCm39) missense possibly damaging 0.86
R1365:Zfp979 UTSW 4 147,697,681 (GRCm39) missense probably benign 0.00
R1440:Zfp979 UTSW 4 147,698,493 (GRCm39) missense possibly damaging 0.96
R1714:Zfp979 UTSW 4 147,698,442 (GRCm39) missense probably damaging 1.00
R1796:Zfp979 UTSW 4 147,697,740 (GRCm39) missense probably damaging 0.99
R2155:Zfp979 UTSW 4 147,697,915 (GRCm39) missense possibly damaging 0.86
R3735:Zfp979 UTSW 4 147,697,939 (GRCm39) missense possibly damaging 0.93
R3963:Zfp979 UTSW 4 147,697,588 (GRCm39) missense probably benign 0.34
R3972:Zfp979 UTSW 4 147,702,876 (GRCm39) nonsense probably null
R4471:Zfp979 UTSW 4 147,697,913 (GRCm39) nonsense probably null
R5310:Zfp979 UTSW 4 147,698,375 (GRCm39) missense possibly damaging 0.95
R5805:Zfp979 UTSW 4 147,698,067 (GRCm39) missense probably damaging 0.99
R5861:Zfp979 UTSW 4 147,697,966 (GRCm39) nonsense probably null
R6598:Zfp979 UTSW 4 147,698,223 (GRCm39) missense probably damaging 0.99
R6599:Zfp979 UTSW 4 147,698,083 (GRCm39) missense probably benign 0.40
R6925:Zfp979 UTSW 4 147,697,999 (GRCm39) missense possibly damaging 0.86
R7684:Zfp979 UTSW 4 147,697,799 (GRCm39) missense probably damaging 0.99
R7801:Zfp979 UTSW 4 147,698,435 (GRCm39) missense probably damaging 0.96
R8035:Zfp979 UTSW 4 147,697,763 (GRCm39) missense probably damaging 1.00
R8086:Zfp979 UTSW 4 147,698,004 (GRCm39) missense probably damaging 0.99
R8244:Zfp979 UTSW 4 147,697,933 (GRCm39) missense possibly damaging 0.92
R8369:Zfp979 UTSW 4 147,697,548 (GRCm39) missense possibly damaging 0.73
R8880:Zfp979 UTSW 4 147,697,836 (GRCm39) missense probably benign 0.00
R8887:Zfp979 UTSW 4 147,698,219 (GRCm39) missense probably damaging 0.96
R8988:Zfp979 UTSW 4 147,697,984 (GRCm39) missense probably benign
R9016:Zfp979 UTSW 4 147,697,504 (GRCm39) missense possibly damaging 0.68
R9356:Zfp979 UTSW 4 147,698,358 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCACTATTGTTTTGTCTCACAATGG -3'
(R):5'- ACTTACTCCTCATATAAGTAATCCCTG -3'

Sequencing Primer
(F):5'- TGTTTAGAAACCAAAACCTCATCAAG -3'
(R):5'- AAGTAATCCCTGTTATCCCTAATTCC -3'
Posted On 2016-05-10