Incidental Mutation 'R4983:Cdkn2aip'
ID385738
Institutional Source Beutler Lab
Gene Symbol Cdkn2aip
Ensembl Gene ENSMUSG00000038069
Gene NameCDKN2A interacting protein
SynonymsCARF, 4921511I16Rik
MMRRC Submission 042577-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.688) question?
Stock #R4983 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location47709344-47713932 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47712929 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 114 (L114Q)
Ref Sequence ENSEMBL: ENSMUSP00000043713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038738] [ENSMUST00000212175]
Predicted Effect probably damaging
Transcript: ENSMUST00000038738
AA Change: L114Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043713
Gene: ENSMUSG00000038069
AA Change: L114Q

DomainStartEndE-ValueType
Pfam:XTBD 19 117 1e-34 PFAM
low complexity region 168 199 N/A INTRINSIC
low complexity region 204 216 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
low complexity region 270 280 N/A INTRINSIC
low complexity region 303 356 N/A INTRINSIC
low complexity region 378 397 N/A INTRINSIC
Blast:DSRM 449 514 4e-6 BLAST
low complexity region 515 531 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180928
SMART Domains Protein: ENSMUSP00000137808
Gene: ENSMUSG00000097706

DomainStartEndE-ValueType
low complexity region 112 120 N/A INTRINSIC
low complexity region 196 207 N/A INTRINSIC
low complexity region 234 239 N/A INTRINSIC
low complexity region 259 292 N/A INTRINSIC
low complexity region 302 312 N/A INTRINSIC
low complexity region 316 331 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212175
AA Change: L114Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212658
Meta Mutation Damage Score 0.7005 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (103/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene regulates the DNA damage response through several different signaling pathways. One such pathway is the p53-HDM2-p21(WAF1) pathway, which is critical to the DNA damage response. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik T G 19: 42,053,076 S215R possibly damaging Het
9130011E15Rik T C 19: 45,950,707 T335A probably benign Het
Abcc9 T C 6: 142,682,141 M388V probably benign Het
Acbd6 A C 1: 155,601,529 T154P probably benign Het
Ago1 T C 4: 126,453,654 D434G probably damaging Het
Ankib1 A T 5: 3,769,652 M89K probably benign Het
Arap2 A T 5: 62,676,525 H866Q probably damaging Het
BC017158 C T 7: 128,276,473 probably benign Het
Capn12 A T 7: 28,890,370 H622L probably benign Het
Capns2 T G 8: 92,901,902 F140V probably damaging Het
Catsper1 T G 19: 5,335,963 F75V probably benign Het
Ccdc24 T C 4: 117,872,100 N16S probably benign Het
Cenpe T A 3: 135,234,928 S649R probably damaging Het
Chgb A T 2: 132,793,682 R515W probably damaging Het
Chrnb1 A G 11: 69,793,978 F123S probably damaging Het
Copz2 A T 11: 96,857,551 probably null Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Daw1 C A 1: 83,187,998 A178E probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epb41l5 T C 1: 119,555,071 D629G probably benign Het
Erap1 A G 13: 74,690,710 E925G probably benign Het
Exoc7 A C 11: 116,289,269 F657V probably damaging Het
Fam210b G C 2: 172,345,665 A2P probably damaging Homo
Fry A G 5: 150,398,254 E1018G probably damaging Het
Galc A T 12: 98,242,768 L15* probably null Het
Gm11232 T A 4: 71,756,901 K121N possibly damaging Het
Gm17677 T G 9: 35,742,169 F90V probably benign Het
Hectd1 A T 12: 51,784,262 D931E probably benign Het
Hecw2 T C 1: 53,832,671 H1372R probably benign Het
Ighv3-2 T A 12: 114,033,986 noncoding transcript Het
Kcns2 T G 15: 34,839,605 S371R probably damaging Het
Kif23 T C 9: 61,936,703 K175E probably benign Het
Kmt2c G A 5: 25,295,511 R436W possibly damaging Het
Lama5 A G 2: 180,193,449 S1317P probably benign Het
Lce1e T C 3: 92,707,828 S71G unknown Het
Lrrc37a T A 11: 103,497,618 E2327V unknown Het
Map3k20 A G 2: 72,402,067 M356V probably benign Het
Med12l C T 3: 59,261,929 A1580V probably damaging Het
Metap2 G T 10: 93,889,600 T30K possibly damaging Het
Mysm1 T A 4: 94,972,970 T53S probably benign Het
Nasp A T 4: 116,602,185 D717E probably damaging Het
Ndnf G A 6: 65,703,571 R278H possibly damaging Het
Neb A T 2: 52,216,261 N4205K probably damaging Het
Nebl A T 2: 17,375,271 I764N possibly damaging Het
Nucb1 A G 7: 45,498,889 Y131H probably damaging Het
Olfr1157 G T 2: 87,962,698 H65N probably benign Het
Olfr292 A C 7: 86,694,479 T8P probably benign Het
Olfr381 A G 11: 73,486,797 I9T probably benign Het
Oscp1 T A 4: 126,076,762 C115S probably benign Het
Paip2 C T 18: 35,613,359 R59C possibly damaging Het
Pcdhga4 G A 18: 37,686,519 D374N probably damaging Het
Pcolce G T 5: 137,605,674 probably benign Het
Pcyox1l T C 18: 61,699,397 E193G probably damaging Het
Pde6b A T 5: 108,425,330 Q522L probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phf11a A G 14: 59,284,438 F95L probably benign Het
Pja2 A C 17: 64,309,058 S281A probably benign Het
Plekhm2 A G 4: 141,634,376 F272S probably damaging Het
Pom121l2 T C 13: 21,983,814 S752P probably benign Het
Ppl T C 16: 5,088,718 T1238A possibly damaging Het
Prmt7 A G 8: 106,250,363 Y569C probably damaging Het
Prss37 G A 6: 40,516,136 T132I probably benign Het
Psmf1 A T 2: 151,729,457 probably benign Het
Ptprj A C 2: 90,460,532 I528S probably damaging Het
Reg1 A G 6: 78,428,213 T140A possibly damaging Het
Rtn4 A G 11: 29,707,217 N457S probably benign Het
Scn9a T C 2: 66,566,270 K93R probably benign Het
Sec16a A G 2: 26,439,519 V828A probably benign Het
Sec23b T A 2: 144,581,953 D507E probably benign Het
Sirt4 A T 5: 115,482,791 F107L probably benign Het
Slc14a2 A T 18: 78,150,401 L862Q probably damaging Het
Slc16a4 T C 3: 107,300,860 S229P probably benign Het
Slc37a3 A T 6: 39,352,717 C185* probably null Het
Slc5a2 A T 7: 128,271,810 *154C probably null Het
Snx17 A G 5: 31,195,794 S42G possibly damaging Het
Tgm6 T C 2: 130,141,193 V234A probably damaging Het
Thbs4 A G 13: 92,790,699 M94T probably benign Het
Thtpa A G 14: 55,072,148 probably benign Het
Tie1 T C 4: 118,483,755 E343G probably damaging Het
Tmem145 A G 7: 25,308,602 I238V probably benign Het
Tmprss11f T C 5: 86,537,999 S170G probably benign Het
Tnk2 T A 16: 32,680,465 D865E probably damaging Het
Ttll8 T C 15: 88,925,582 E337G probably benign Het
Ttn G A 2: 76,867,446 probably benign Het
Tubgcp6 T C 15: 89,106,291 E710G probably damaging Het
Txndc2 T A 17: 65,638,060 H374L probably benign Het
Unc80 G T 1: 66,674,732 probably null Het
Vmn2r23 G A 6: 123,733,349 C537Y probably damaging Het
Vmn2r45 A G 7: 8,483,117 F391L probably damaging Het
Vstm4 A T 14: 32,919,245 T262S probably benign Het
Zfp180 C T 7: 24,106,078 R641C probably damaging Het
Zfp979 A T 4: 147,613,914 S113T possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Zswim5 T A 4: 116,985,686 M876K possibly damaging Het
Other mutations in Cdkn2aip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Cdkn2aip APN 8 47711212 missense probably damaging 0.98
IGL02422:Cdkn2aip APN 8 47711499 missense probably damaging 0.98
IGL03346:Cdkn2aip APN 8 47713618 missense probably benign
R0269:Cdkn2aip UTSW 8 47711977 missense probably damaging 0.99
R0557:Cdkn2aip UTSW 8 47712942 missense probably damaging 0.99
R0788:Cdkn2aip UTSW 8 47713763 missense possibly damaging 0.95
R1915:Cdkn2aip UTSW 8 47711926 missense probably benign 0.24
R1990:Cdkn2aip UTSW 8 47712176 missense probably benign 0.27
R2101:Cdkn2aip UTSW 8 47713001 missense probably damaging 0.98
R3081:Cdkn2aip UTSW 8 47711497 missense probably damaging 0.97
R4324:Cdkn2aip UTSW 8 47712173 missense probably benign 0.00
R4765:Cdkn2aip UTSW 8 47713547 missense probably damaging 1.00
R4985:Cdkn2aip UTSW 8 47713445 intron probably benign
R6968:Cdkn2aip UTSW 8 47713887 start gained probably benign
R7402:Cdkn2aip UTSW 8 47711373 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCATCAGACATTGGACTTGAAAATC -3'
(R):5'- TCACGCTGCCAGTACTTTCG -3'

Sequencing Primer
(F):5'- GTTAATCAAATTCAGCACCAAAACAG -3'
(R):5'- AACCACTTCTTGAGAGCG -3'
Posted On2016-05-10