Incidental Mutation 'R4983:Hectd1'
ID385752
Institutional Source Beutler Lab
Gene Symbol Hectd1
Ensembl Gene ENSMUSG00000035247
Gene NameHECT domain E3 ubiquitin protein ligase 1
Synonymsb2b327Clo, opm, A630086P08Rik
MMRRC Submission 042577-MU
Accession Numbers

Genbank: NM_144788; MGI: 2384768

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4983 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location51743722-51829536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51784262 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 931 (D931E)
Ref Sequence ENSEMBL: ENSMUSP00000046766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042052] [ENSMUST00000179265]
Predicted Effect probably benign
Transcript: ENSMUST00000042052
AA Change: D931E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000046766
Gene: ENSMUSG00000035247
AA Change: D931E

DomainStartEndE-ValueType
low complexity region 317 331 N/A INTRINSIC
ANK 395 424 1.44e-1 SMART
ANK 426 455 2.81e-4 SMART
ANK 459 488 1.55e2 SMART
low complexity region 490 509 N/A INTRINSIC
low complexity region 630 654 N/A INTRINSIC
low complexity region 707 723 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
Pfam:Sad1_UNC 1107 1240 9.2e-27 PFAM
low complexity region 1259 1271 N/A INTRINSIC
Pfam:MIB_HERC2 1277 1338 7.6e-27 PFAM
low complexity region 1373 1401 N/A INTRINSIC
low complexity region 1441 1458 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1508 1524 N/A INTRINSIC
low complexity region 1600 1630 N/A INTRINSIC
low complexity region 1633 1651 N/A INTRINSIC
low complexity region 1674 1703 N/A INTRINSIC
low complexity region 1745 1752 N/A INTRINSIC
PDB:2LC3|A 1879 1966 4e-57 PDB
low complexity region 2101 2117 N/A INTRINSIC
HECTc 2143 2610 8.32e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179265
SMART Domains Protein: ENSMUSP00000136449
Gene: ENSMUSG00000035247

DomainStartEndE-ValueType
low complexity region 317 331 N/A INTRINSIC
ANK 396 425 1.44e-1 SMART
ANK 427 456 2.81e-4 SMART
ANK 460 489 1.55e2 SMART
low complexity region 491 510 N/A INTRINSIC
low complexity region 631 655 N/A INTRINSIC
low complexity region 708 724 N/A INTRINSIC
low complexity region 822 833 N/A INTRINSIC
Pfam:Sad1_UNC 1112 1245 1.3e-26 PFAM
low complexity region 1264 1276 N/A INTRINSIC
Pfam:MIB_HERC2 1282 1341 5.3e-26 PFAM
low complexity region 1378 1406 N/A INTRINSIC
low complexity region 1446 1463 N/A INTRINSIC
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1513 1529 N/A INTRINSIC
low complexity region 1605 1635 N/A INTRINSIC
low complexity region 1638 1656 N/A INTRINSIC
low complexity region 1679 1708 N/A INTRINSIC
low complexity region 1750 1757 N/A INTRINSIC
PDB:2LC3|A 1884 1971 3e-57 PDB
low complexity region 2106 2122 N/A INTRINSIC
HECTc 2148 2618 4.5e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220098
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (103/106)
MGI Phenotype PHENOTYPE: Mice that are homozygous for either a gene trapped or an ENU-induced allele exhibit exencephaly associated with impaired head mesenchyme development and neural tube closure, and show eye and cranial vault dysplasia. Homozygotes for another ENU-induced allele show congenital cardiovascular defects. [provided by MGI curators]
Allele List at MGI

All alleles(30) : Gene trapped(29) Chemically induced(1)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik T G 19: 42,053,076 S215R possibly damaging Het
9130011E15Rik T C 19: 45,950,707 T335A probably benign Het
Abcc9 T C 6: 142,682,141 M388V probably benign Het
Acbd6 A C 1: 155,601,529 T154P probably benign Het
Ago1 T C 4: 126,453,654 D434G probably damaging Het
Ankib1 A T 5: 3,769,652 M89K probably benign Het
Arap2 A T 5: 62,676,525 H866Q probably damaging Het
BC017158 C T 7: 128,276,473 probably benign Het
Capn12 A T 7: 28,890,370 H622L probably benign Het
Capns2 T G 8: 92,901,902 F140V probably damaging Het
Catsper1 T G 19: 5,335,963 F75V probably benign Het
Ccdc24 T C 4: 117,872,100 N16S probably benign Het
Cdkn2aip A T 8: 47,712,929 L114Q probably damaging Het
Cenpe T A 3: 135,234,928 S649R probably damaging Het
Chgb A T 2: 132,793,682 R515W probably damaging Het
Chrnb1 A G 11: 69,793,978 F123S probably damaging Het
Copz2 A T 11: 96,857,551 probably null Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Daw1 C A 1: 83,187,998 A178E probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epb41l5 T C 1: 119,555,071 D629G probably benign Het
Erap1 A G 13: 74,690,710 E925G probably benign Het
Exoc7 A C 11: 116,289,269 F657V probably damaging Het
Fam210b G C 2: 172,345,665 A2P probably damaging Homo
Fry A G 5: 150,398,254 E1018G probably damaging Het
Galc A T 12: 98,242,768 L15* probably null Het
Gm11232 T A 4: 71,756,901 K121N possibly damaging Het
Gm17677 T G 9: 35,742,169 F90V probably benign Het
Hecw2 T C 1: 53,832,671 H1372R probably benign Het
Ighv3-2 T A 12: 114,033,986 noncoding transcript Het
Kcns2 T G 15: 34,839,605 S371R probably damaging Het
Kif23 T C 9: 61,936,703 K175E probably benign Het
Kmt2c G A 5: 25,295,511 R436W possibly damaging Het
Lama5 A G 2: 180,193,449 S1317P probably benign Het
Lce1e T C 3: 92,707,828 S71G unknown Het
Lrrc37a T A 11: 103,497,618 E2327V unknown Het
Map3k20 A G 2: 72,402,067 M356V probably benign Het
Med12l C T 3: 59,261,929 A1580V probably damaging Het
Metap2 G T 10: 93,889,600 T30K possibly damaging Het
Mysm1 T A 4: 94,972,970 T53S probably benign Het
Nasp A T 4: 116,602,185 D717E probably damaging Het
Ndnf G A 6: 65,703,571 R278H possibly damaging Het
Neb A T 2: 52,216,261 N4205K probably damaging Het
Nebl A T 2: 17,375,271 I764N possibly damaging Het
Nucb1 A G 7: 45,498,889 Y131H probably damaging Het
Olfr1157 G T 2: 87,962,698 H65N probably benign Het
Olfr292 A C 7: 86,694,479 T8P probably benign Het
Olfr381 A G 11: 73,486,797 I9T probably benign Het
Oscp1 T A 4: 126,076,762 C115S probably benign Het
Paip2 C T 18: 35,613,359 R59C possibly damaging Het
Pcdhga4 G A 18: 37,686,519 D374N probably damaging Het
Pcolce G T 5: 137,605,674 probably benign Het
Pcyox1l T C 18: 61,699,397 E193G probably damaging Het
Pde6b A T 5: 108,425,330 Q522L probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phf11a A G 14: 59,284,438 F95L probably benign Het
Pja2 A C 17: 64,309,058 S281A probably benign Het
Plekhm2 A G 4: 141,634,376 F272S probably damaging Het
Pom121l2 T C 13: 21,983,814 S752P probably benign Het
Ppl T C 16: 5,088,718 T1238A possibly damaging Het
Prmt7 A G 8: 106,250,363 Y569C probably damaging Het
Prss37 G A 6: 40,516,136 T132I probably benign Het
Psmf1 A T 2: 151,729,457 probably benign Het
Ptprj A C 2: 90,460,532 I528S probably damaging Het
Reg1 A G 6: 78,428,213 T140A possibly damaging Het
Rtn4 A G 11: 29,707,217 N457S probably benign Het
Scn9a T C 2: 66,566,270 K93R probably benign Het
Sec16a A G 2: 26,439,519 V828A probably benign Het
Sec23b T A 2: 144,581,953 D507E probably benign Het
Sirt4 A T 5: 115,482,791 F107L probably benign Het
Slc14a2 A T 18: 78,150,401 L862Q probably damaging Het
Slc16a4 T C 3: 107,300,860 S229P probably benign Het
Slc37a3 A T 6: 39,352,717 C185* probably null Het
Slc5a2 A T 7: 128,271,810 *154C probably null Het
Snx17 A G 5: 31,195,794 S42G possibly damaging Het
Tgm6 T C 2: 130,141,193 V234A probably damaging Het
Thbs4 A G 13: 92,790,699 M94T probably benign Het
Thtpa A G 14: 55,072,148 probably benign Het
Tie1 T C 4: 118,483,755 E343G probably damaging Het
Tmem145 A G 7: 25,308,602 I238V probably benign Het
Tmprss11f T C 5: 86,537,999 S170G probably benign Het
Tnk2 T A 16: 32,680,465 D865E probably damaging Het
Ttll8 T C 15: 88,925,582 E337G probably benign Het
Ttn G A 2: 76,867,446 probably benign Het
Tubgcp6 T C 15: 89,106,291 E710G probably damaging Het
Txndc2 T A 17: 65,638,060 H374L probably benign Het
Unc80 G T 1: 66,674,732 probably null Het
Vmn2r23 G A 6: 123,733,349 C537Y probably damaging Het
Vmn2r45 A G 7: 8,483,117 F391L probably damaging Het
Vstm4 A T 14: 32,919,245 T262S probably benign Het
Zfp180 C T 7: 24,106,078 R641C probably damaging Het
Zfp979 A T 4: 147,613,914 S113T possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Zswim5 T A 4: 116,985,686 M876K possibly damaging Het
Other mutations in Hectd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Hectd1 APN 12 51769108 missense possibly damaging 0.94
IGL00402:Hectd1 APN 12 51759432 missense probably benign
IGL00419:Hectd1 APN 12 51764035 missense probably damaging 0.99
IGL00518:Hectd1 APN 12 51776489 splice site probably benign
IGL00565:Hectd1 APN 12 51790398 missense probably damaging 0.97
IGL00574:Hectd1 APN 12 51774004 missense probably benign 0.17
IGL00576:Hectd1 APN 12 51759309 missense probably damaging 0.99
IGL00788:Hectd1 APN 12 51748788 missense probably damaging 0.99
IGL00978:Hectd1 APN 12 51791390 missense possibly damaging 0.95
IGL01328:Hectd1 APN 12 51761121 missense probably damaging 1.00
IGL01337:Hectd1 APN 12 51802274 missense possibly damaging 0.95
IGL01634:Hectd1 APN 12 51803779 missense probably damaging 0.98
IGL01731:Hectd1 APN 12 51802810 missense possibly damaging 0.59
IGL01920:Hectd1 APN 12 51782554 missense probably damaging 0.99
IGL01951:Hectd1 APN 12 51794497 nonsense probably null
IGL01994:Hectd1 APN 12 51797942 missense probably damaging 0.99
IGL02140:Hectd1 APN 12 51774137 missense probably damaging 0.99
IGL02150:Hectd1 APN 12 51769191 missense probably damaging 0.97
IGL02156:Hectd1 APN 12 51754133 splice site probably benign
IGL02177:Hectd1 APN 12 51772320 missense probably damaging 0.99
IGL02502:Hectd1 APN 12 51797852 missense possibly damaging 0.77
IGL02505:Hectd1 APN 12 51800713 critical splice donor site probably null
IGL02519:Hectd1 APN 12 51769111 missense probably damaging 0.99
IGL02624:Hectd1 APN 12 51762450 missense possibly damaging 0.61
IGL02833:Hectd1 APN 12 51764081 missense probably damaging 0.96
IGL02851:Hectd1 APN 12 51767640 missense possibly damaging 0.94
IGL02866:Hectd1 APN 12 51790613 missense probably damaging 1.00
IGL02981:Hectd1 APN 12 51768887 missense possibly damaging 0.70
IGL02987:Hectd1 APN 12 51744767 missense probably damaging 1.00
IGL02999:Hectd1 APN 12 51827422 missense possibly damaging 0.77
IGL03071:Hectd1 APN 12 51769174 missense probably benign 0.00
IGL03078:Hectd1 APN 12 51802236 missense probably damaging 0.98
IGL03299:Hectd1 APN 12 51800888 splice site probably benign
3-1:Hectd1 UTSW 12 51753807 missense probably damaging 0.99
R0039:Hectd1 UTSW 12 51753825 missense possibly damaging 0.83
R0238:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0238:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0239:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0239:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0268:Hectd1 UTSW 12 51769107 missense probably damaging 0.99
R0268:Hectd1 UTSW 12 51769108 missense possibly damaging 0.94
R0409:Hectd1 UTSW 12 51782556 missense possibly damaging 0.59
R1019:Hectd1 UTSW 12 51748657 missense probably damaging 0.99
R1072:Hectd1 UTSW 12 51761072 missense probably benign 0.11
R1087:Hectd1 UTSW 12 51776572 missense probably damaging 0.99
R1165:Hectd1 UTSW 12 51764164 splice site probably benign
R1350:Hectd1 UTSW 12 51762434 missense probably benign
R1553:Hectd1 UTSW 12 51773878 missense probably damaging 0.98
R1666:Hectd1 UTSW 12 51753824 missense possibly damaging 0.91
R1676:Hectd1 UTSW 12 51744788 missense probably damaging 1.00
R1694:Hectd1 UTSW 12 51744592 missense probably damaging 1.00
R1778:Hectd1 UTSW 12 51753807 missense probably damaging 0.99
R1856:Hectd1 UTSW 12 51744794 missense probably damaging 1.00
R1859:Hectd1 UTSW 12 51806567 missense probably damaging 1.00
R1884:Hectd1 UTSW 12 51800955 missense probably benign 0.00
R1982:Hectd1 UTSW 12 51785841 missense probably damaging 0.97
R2034:Hectd1 UTSW 12 51757116 splice site probably null
R2061:Hectd1 UTSW 12 51794444 missense probably damaging 0.99
R2078:Hectd1 UTSW 12 51748542 missense probably damaging 0.99
R2176:Hectd1 UTSW 12 51745494 missense probably damaging 1.00
R2210:Hectd1 UTSW 12 51806462 missense probably damaging 0.99
R2248:Hectd1 UTSW 12 51806471 missense probably damaging 0.99
R2282:Hectd1 UTSW 12 51769008 missense possibly damaging 0.95
R2402:Hectd1 UTSW 12 51745534 missense probably benign 0.01
R3876:Hectd1 UTSW 12 51768730 missense probably damaging 0.98
R4027:Hectd1 UTSW 12 51802436 critical splice acceptor site probably null
R4085:Hectd1 UTSW 12 51774750 missense possibly damaging 0.93
R4115:Hectd1 UTSW 12 51768723 nonsense probably null
R4116:Hectd1 UTSW 12 51768723 nonsense probably null
R4169:Hectd1 UTSW 12 51790225 missense probably damaging 0.97
R4434:Hectd1 UTSW 12 51752052 missense probably damaging 1.00
R4507:Hectd1 UTSW 12 51790493 missense probably damaging 0.97
R4578:Hectd1 UTSW 12 51751932 missense probably damaging 1.00
R4579:Hectd1 UTSW 12 51744573 missense probably damaging 0.97
R4709:Hectd1 UTSW 12 51787912 missense possibly damaging 0.94
R4812:Hectd1 UTSW 12 51827351 critical splice donor site probably null
R4883:Hectd1 UTSW 12 51784247 nonsense probably null
R4885:Hectd1 UTSW 12 51800722 missense probably damaging 0.97
R4975:Hectd1 UTSW 12 51762497 missense probably benign 0.02
R5007:Hectd1 UTSW 12 51802660 missense possibly damaging 0.95
R5046:Hectd1 UTSW 12 51750388 missense probably damaging 1.00
R5062:Hectd1 UTSW 12 51744879 missense probably damaging 0.98
R5164:Hectd1 UTSW 12 51827489 start codon destroyed probably null 0.60
R5213:Hectd1 UTSW 12 51802533 critical splice donor site probably null
R5535:Hectd1 UTSW 12 51802326 missense probably damaging 0.98
R5776:Hectd1 UTSW 12 51764114 missense possibly damaging 0.91
R5846:Hectd1 UTSW 12 51773835 missense probably damaging 0.99
R5907:Hectd1 UTSW 12 51798754 missense probably damaging 0.98
R5911:Hectd1 UTSW 12 51802252 missense probably damaging 0.99
R5919:Hectd1 UTSW 12 51769072 missense probably damaging 0.98
R6051:Hectd1 UTSW 12 51754104 missense probably benign
R6141:Hectd1 UTSW 12 51746092 critical splice donor site probably null
R6172:Hectd1 UTSW 12 51769282 missense probably damaging 1.00
R6194:Hectd1 UTSW 12 51748445 missense probably damaging 0.99
R6356:Hectd1 UTSW 12 51744619 missense probably damaging 1.00
R6795:Hectd1 UTSW 12 51794487 missense possibly damaging 0.94
R6909:Hectd1 UTSW 12 51764162 splice site probably null
R6971:Hectd1 UTSW 12 51748743 nonsense probably null
R7079:Hectd1 UTSW 12 51787855 missense possibly damaging 0.96
R7104:Hectd1 UTSW 12 51827351 critical splice donor site probably null
R7171:Hectd1 UTSW 12 51759297 missense probably damaging 0.99
R7296:Hectd1 UTSW 12 51785852 missense possibly damaging 0.73
R7346:Hectd1 UTSW 12 51750321 missense probably benign
R7355:Hectd1 UTSW 12 51791298 missense possibly damaging 0.72
R7468:Hectd1 UTSW 12 51744805 splice site probably null
R7531:Hectd1 UTSW 12 51806367 missense probably benign 0.33
R7532:Hectd1 UTSW 12 51790450 missense probably damaging 0.98
R7755:Hectd1 UTSW 12 51802220 missense possibly damaging 0.86
R7807:Hectd1 UTSW 12 51745388 missense probably damaging 1.00
R7842:Hectd1 UTSW 12 51772560 missense probably damaging 0.99
R7922:Hectd1 UTSW 12 51790195 nonsense probably null
R8059:Hectd1 UTSW 12 51790378 missense possibly damaging 0.53
R8085:Hectd1 UTSW 12 51748896 missense probably damaging 0.97
R8145:Hectd1 UTSW 12 51784233 missense possibly damaging 0.72
R8157:Hectd1 UTSW 12 51791290 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AAGCATGTGACAAGCATGTG -3'
(R):5'- TAAGCTTGCACAGTTAACGTTAGTG -3'

Sequencing Primer
(F):5'- CATGTGACAAGCATGTGATGAGC -3'
(R):5'- AAGTGCATATTAGTCCCCGC -3'
Posted On2016-05-10