Incidental Mutation 'R4983:Ttll8'
ID385762
Institutional Source Beutler Lab
Gene Symbol Ttll8
Ensembl Gene ENSMUSG00000022388
Gene Nametubulin tyrosine ligase-like family, member 8
Synonyms1700019P01Rik
MMRRC Submission 042577-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R4983 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location88890633-88954418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88925582 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 337 (E337G)
Ref Sequence ENSEMBL: ENSMUSP00000104996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109371] [ENSMUST00000177180]
Predicted Effect probably benign
Transcript: ENSMUST00000109371
AA Change: E337G

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000104996
Gene: ENSMUSG00000022388
AA Change: E337G

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
Pfam:TTL 324 621 3.9e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177180
SMART Domains Protein: ENSMUSP00000135381
Gene: ENSMUSG00000022388

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177254
Meta Mutation Damage Score 0.1438 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (103/106)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik T G 19: 42,053,076 S215R possibly damaging Het
9130011E15Rik T C 19: 45,950,707 T335A probably benign Het
Abcc9 T C 6: 142,682,141 M388V probably benign Het
Acbd6 A C 1: 155,601,529 T154P probably benign Het
Ago1 T C 4: 126,453,654 D434G probably damaging Het
Ankib1 A T 5: 3,769,652 M89K probably benign Het
Arap2 A T 5: 62,676,525 H866Q probably damaging Het
BC017158 C T 7: 128,276,473 probably benign Het
Capn12 A T 7: 28,890,370 H622L probably benign Het
Capns2 T G 8: 92,901,902 F140V probably damaging Het
Catsper1 T G 19: 5,335,963 F75V probably benign Het
Ccdc24 T C 4: 117,872,100 N16S probably benign Het
Cdkn2aip A T 8: 47,712,929 L114Q probably damaging Het
Cenpe T A 3: 135,234,928 S649R probably damaging Het
Chgb A T 2: 132,793,682 R515W probably damaging Het
Chrnb1 A G 11: 69,793,978 F123S probably damaging Het
Copz2 A T 11: 96,857,551 probably null Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Daw1 C A 1: 83,187,998 A178E probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epb41l5 T C 1: 119,555,071 D629G probably benign Het
Erap1 A G 13: 74,690,710 E925G probably benign Het
Exoc7 A C 11: 116,289,269 F657V probably damaging Het
Fam210b G C 2: 172,345,665 A2P probably damaging Homo
Fry A G 5: 150,398,254 E1018G probably damaging Het
Galc A T 12: 98,242,768 L15* probably null Het
Gm11232 T A 4: 71,756,901 K121N possibly damaging Het
Gm17677 T G 9: 35,742,169 F90V probably benign Het
Hectd1 A T 12: 51,784,262 D931E probably benign Het
Hecw2 T C 1: 53,832,671 H1372R probably benign Het
Ighv3-2 T A 12: 114,033,986 noncoding transcript Het
Kcns2 T G 15: 34,839,605 S371R probably damaging Het
Kif23 T C 9: 61,936,703 K175E probably benign Het
Kmt2c G A 5: 25,295,511 R436W possibly damaging Het
Lama5 A G 2: 180,193,449 S1317P probably benign Het
Lce1e T C 3: 92,707,828 S71G unknown Het
Lrrc37a T A 11: 103,497,618 E2327V unknown Het
Map3k20 A G 2: 72,402,067 M356V probably benign Het
Med12l C T 3: 59,261,929 A1580V probably damaging Het
Metap2 G T 10: 93,889,600 T30K possibly damaging Het
Mysm1 T A 4: 94,972,970 T53S probably benign Het
Nasp A T 4: 116,602,185 D717E probably damaging Het
Ndnf G A 6: 65,703,571 R278H possibly damaging Het
Neb A T 2: 52,216,261 N4205K probably damaging Het
Nebl A T 2: 17,375,271 I764N possibly damaging Het
Nucb1 A G 7: 45,498,889 Y131H probably damaging Het
Olfr1157 G T 2: 87,962,698 H65N probably benign Het
Olfr292 A C 7: 86,694,479 T8P probably benign Het
Olfr381 A G 11: 73,486,797 I9T probably benign Het
Oscp1 T A 4: 126,076,762 C115S probably benign Het
Paip2 C T 18: 35,613,359 R59C possibly damaging Het
Pcdhga4 G A 18: 37,686,519 D374N probably damaging Het
Pcolce G T 5: 137,605,674 probably benign Het
Pcyox1l T C 18: 61,699,397 E193G probably damaging Het
Pde6b A T 5: 108,425,330 Q522L probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phf11a A G 14: 59,284,438 F95L probably benign Het
Pja2 A C 17: 64,309,058 S281A probably benign Het
Plekhm2 A G 4: 141,634,376 F272S probably damaging Het
Pom121l2 T C 13: 21,983,814 S752P probably benign Het
Ppl T C 16: 5,088,718 T1238A possibly damaging Het
Prmt7 A G 8: 106,250,363 Y569C probably damaging Het
Prss37 G A 6: 40,516,136 T132I probably benign Het
Psmf1 A T 2: 151,729,457 probably benign Het
Ptprj A C 2: 90,460,532 I528S probably damaging Het
Reg1 A G 6: 78,428,213 T140A possibly damaging Het
Rtn4 A G 11: 29,707,217 N457S probably benign Het
Scn9a T C 2: 66,566,270 K93R probably benign Het
Sec16a A G 2: 26,439,519 V828A probably benign Het
Sec23b T A 2: 144,581,953 D507E probably benign Het
Sirt4 A T 5: 115,482,791 F107L probably benign Het
Slc14a2 A T 18: 78,150,401 L862Q probably damaging Het
Slc16a4 T C 3: 107,300,860 S229P probably benign Het
Slc37a3 A T 6: 39,352,717 C185* probably null Het
Slc5a2 A T 7: 128,271,810 *154C probably null Het
Snx17 A G 5: 31,195,794 S42G possibly damaging Het
Tgm6 T C 2: 130,141,193 V234A probably damaging Het
Thbs4 A G 13: 92,790,699 M94T probably benign Het
Thtpa A G 14: 55,072,148 probably benign Het
Tie1 T C 4: 118,483,755 E343G probably damaging Het
Tmem145 A G 7: 25,308,602 I238V probably benign Het
Tmprss11f T C 5: 86,537,999 S170G probably benign Het
Tnk2 T A 16: 32,680,465 D865E probably damaging Het
Ttn G A 2: 76,867,446 probably benign Het
Tubgcp6 T C 15: 89,106,291 E710G probably damaging Het
Txndc2 T A 17: 65,638,060 H374L probably benign Het
Unc80 G T 1: 66,674,732 probably null Het
Vmn2r23 G A 6: 123,733,349 C537Y probably damaging Het
Vmn2r45 A G 7: 8,483,117 F391L probably damaging Het
Vstm4 A T 14: 32,919,245 T262S probably benign Het
Zfp180 C T 7: 24,106,078 R641C probably damaging Het
Zfp979 A T 4: 147,613,914 S113T possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Zswim5 T A 4: 116,985,686 M876K possibly damaging Het
Other mutations in Ttll8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Ttll8 APN 15 88914153 missense probably benign
IGL00895:Ttll8 APN 15 88933528 missense probably damaging 1.00
IGL01061:Ttll8 APN 15 88917250 missense possibly damaging 0.85
IGL01661:Ttll8 APN 15 88935999 splice site probably benign
IGL01992:Ttll8 APN 15 88915645 missense possibly damaging 0.48
IGL02212:Ttll8 APN 15 88917247 missense probably benign 0.04
IGL02234:Ttll8 APN 15 88914049 missense possibly damaging 0.53
IGL02569:Ttll8 APN 15 88933926 nonsense probably null
IGL02935:Ttll8 APN 15 88914556 missense probably benign 0.10
IGL03064:Ttll8 APN 15 88919594 missense probably benign 0.22
R0969:Ttll8 UTSW 15 88933935 missense probably damaging 1.00
R1637:Ttll8 UTSW 15 88914444 missense probably benign 0.12
R1939:Ttll8 UTSW 15 88915486 missense probably damaging 1.00
R1992:Ttll8 UTSW 15 88914451 missense probably benign 0.00
R2173:Ttll8 UTSW 15 88914597 missense probably damaging 1.00
R2201:Ttll8 UTSW 15 88933953 missense possibly damaging 0.57
R2414:Ttll8 UTSW 15 88936133 splice site probably benign
R2905:Ttll8 UTSW 15 88914477 missense probably benign 0.00
R4159:Ttll8 UTSW 15 88917241 missense probably benign 0.00
R4368:Ttll8 UTSW 15 88914181 missense possibly damaging 0.88
R4395:Ttll8 UTSW 15 88915580 missense possibly damaging 0.80
R4707:Ttll8 UTSW 15 88917090 missense probably damaging 0.99
R4926:Ttll8 UTSW 15 88914165 missense probably damaging 0.98
R5698:Ttll8 UTSW 15 88939006 missense possibly damaging 0.85
R5752:Ttll8 UTSW 15 88932728 missense probably benign 0.00
R5834:Ttll8 UTSW 15 88917246 missense possibly damaging 0.48
R5889:Ttll8 UTSW 15 88933939 missense probably damaging 1.00
R6528:Ttll8 UTSW 15 88914238 missense probably benign 0.03
R6931:Ttll8 UTSW 15 88914304 missense possibly damaging 0.55
R7133:Ttll8 UTSW 15 88915427 missense probably damaging 0.99
R7268:Ttll8 UTSW 15 88934956 critical splice donor site probably null
R7286:Ttll8 UTSW 15 88917239 missense probably benign 0.01
R7502:Ttll8 UTSW 15 88933436 critical splice donor site probably null
R7580:Ttll8 UTSW 15 88933929 missense probably damaging 0.99
R7734:Ttll8 UTSW 15 88914165 missense probably damaging 0.98
R7978:Ttll8 UTSW 15 88915362 missense probably benign 0.09
R8074:Ttll8 UTSW 15 88915375 missense probably damaging 1.00
X0058:Ttll8 UTSW 15 88917130 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTAACAACAGGGTAAGTCC -3'
(R):5'- ACTGACAGACAAGGCTCCTG -3'

Sequencing Primer
(F):5'- GTCCCCTCAATACCCAGATATGTG -3'
(R):5'- ACAAGGCTCCTGGAGGG -3'
Posted On2016-05-10