Incidental Mutation 'R4983:Pja2'
ID385766
Institutional Source Beutler Lab
Gene Symbol Pja2
Ensembl Gene ENSMUSG00000024083
Gene Namepraja ring finger ubiquitin ligase 2
SynonymsNeurodap1
MMRRC Submission 042577-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4983 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location64281005-64331916 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 64309058 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 281 (S281A)
Ref Sequence ENSEMBL: ENSMUSP00000134380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024888] [ENSMUST00000024889] [ENSMUST00000172733] [ENSMUST00000172818]
Predicted Effect probably benign
Transcript: ENSMUST00000024888
AA Change: S281A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000024888
Gene: ENSMUSG00000024083
AA Change: S281A

DomainStartEndE-ValueType
low complexity region 532 548 N/A INTRINSIC
RING 633 673 3.84e-6 SMART
low complexity region 678 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000024889
AA Change: S281A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000024889
Gene: ENSMUSG00000024083
AA Change: S281A

DomainStartEndE-ValueType
low complexity region 470 486 N/A INTRINSIC
RING 571 611 3.84e-6 SMART
low complexity region 616 641 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172733
AA Change: S281A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000133730
Gene: ENSMUSG00000024083
AA Change: S281A

DomainStartEndE-ValueType
low complexity region 470 486 N/A INTRINSIC
RING 571 611 3.84e-6 SMART
low complexity region 616 641 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172818
AA Change: S281A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000134380
Gene: ENSMUSG00000024083
AA Change: S281A

DomainStartEndE-ValueType
low complexity region 532 548 N/A INTRINSIC
RING 633 673 3.84e-6 SMART
low complexity region 678 703 N/A INTRINSIC
Meta Mutation Damage Score 0.0599 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (103/106)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik T G 19: 42,053,076 S215R possibly damaging Het
9130011E15Rik T C 19: 45,950,707 T335A probably benign Het
Abcc9 T C 6: 142,682,141 M388V probably benign Het
Acbd6 A C 1: 155,601,529 T154P probably benign Het
Ago1 T C 4: 126,453,654 D434G probably damaging Het
Ankib1 A T 5: 3,769,652 M89K probably benign Het
Arap2 A T 5: 62,676,525 H866Q probably damaging Het
BC017158 C T 7: 128,276,473 probably benign Het
Capn12 A T 7: 28,890,370 H622L probably benign Het
Capns2 T G 8: 92,901,902 F140V probably damaging Het
Catsper1 T G 19: 5,335,963 F75V probably benign Het
Ccdc24 T C 4: 117,872,100 N16S probably benign Het
Cdkn2aip A T 8: 47,712,929 L114Q probably damaging Het
Cenpe T A 3: 135,234,928 S649R probably damaging Het
Chgb A T 2: 132,793,682 R515W probably damaging Het
Chrnb1 A G 11: 69,793,978 F123S probably damaging Het
Copz2 A T 11: 96,857,551 probably null Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Daw1 C A 1: 83,187,998 A178E probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epb41l5 T C 1: 119,555,071 D629G probably benign Het
Erap1 A G 13: 74,690,710 E925G probably benign Het
Exoc7 A C 11: 116,289,269 F657V probably damaging Het
Fam210b G C 2: 172,345,665 A2P probably damaging Homo
Fry A G 5: 150,398,254 E1018G probably damaging Het
Galc A T 12: 98,242,768 L15* probably null Het
Gm11232 T A 4: 71,756,901 K121N possibly damaging Het
Gm17677 T G 9: 35,742,169 F90V probably benign Het
Hectd1 A T 12: 51,784,262 D931E probably benign Het
Hecw2 T C 1: 53,832,671 H1372R probably benign Het
Ighv3-2 T A 12: 114,033,986 noncoding transcript Het
Kcns2 T G 15: 34,839,605 S371R probably damaging Het
Kif23 T C 9: 61,936,703 K175E probably benign Het
Kmt2c G A 5: 25,295,511 R436W possibly damaging Het
Lama5 A G 2: 180,193,449 S1317P probably benign Het
Lce1e T C 3: 92,707,828 S71G unknown Het
Lrrc37a T A 11: 103,497,618 E2327V unknown Het
Map3k20 A G 2: 72,402,067 M356V probably benign Het
Med12l C T 3: 59,261,929 A1580V probably damaging Het
Metap2 G T 10: 93,889,600 T30K possibly damaging Het
Mysm1 T A 4: 94,972,970 T53S probably benign Het
Nasp A T 4: 116,602,185 D717E probably damaging Het
Ndnf G A 6: 65,703,571 R278H possibly damaging Het
Neb A T 2: 52,216,261 N4205K probably damaging Het
Nebl A T 2: 17,375,271 I764N possibly damaging Het
Nucb1 A G 7: 45,498,889 Y131H probably damaging Het
Olfr1157 G T 2: 87,962,698 H65N probably benign Het
Olfr292 A C 7: 86,694,479 T8P probably benign Het
Olfr381 A G 11: 73,486,797 I9T probably benign Het
Oscp1 T A 4: 126,076,762 C115S probably benign Het
Paip2 C T 18: 35,613,359 R59C possibly damaging Het
Pcdhga4 G A 18: 37,686,519 D374N probably damaging Het
Pcolce G T 5: 137,605,674 probably benign Het
Pcyox1l T C 18: 61,699,397 E193G probably damaging Het
Pde6b A T 5: 108,425,330 Q522L probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phf11a A G 14: 59,284,438 F95L probably benign Het
Plekhm2 A G 4: 141,634,376 F272S probably damaging Het
Pom121l2 T C 13: 21,983,814 S752P probably benign Het
Ppl T C 16: 5,088,718 T1238A possibly damaging Het
Prmt7 A G 8: 106,250,363 Y569C probably damaging Het
Prss37 G A 6: 40,516,136 T132I probably benign Het
Psmf1 A T 2: 151,729,457 probably benign Het
Ptprj A C 2: 90,460,532 I528S probably damaging Het
Reg1 A G 6: 78,428,213 T140A possibly damaging Het
Rtn4 A G 11: 29,707,217 N457S probably benign Het
Scn9a T C 2: 66,566,270 K93R probably benign Het
Sec16a A G 2: 26,439,519 V828A probably benign Het
Sec23b T A 2: 144,581,953 D507E probably benign Het
Sirt4 A T 5: 115,482,791 F107L probably benign Het
Slc14a2 A T 18: 78,150,401 L862Q probably damaging Het
Slc16a4 T C 3: 107,300,860 S229P probably benign Het
Slc37a3 A T 6: 39,352,717 C185* probably null Het
Slc5a2 A T 7: 128,271,810 *154C probably null Het
Snx17 A G 5: 31,195,794 S42G possibly damaging Het
Tgm6 T C 2: 130,141,193 V234A probably damaging Het
Thbs4 A G 13: 92,790,699 M94T probably benign Het
Thtpa A G 14: 55,072,148 probably benign Het
Tie1 T C 4: 118,483,755 E343G probably damaging Het
Tmem145 A G 7: 25,308,602 I238V probably benign Het
Tmprss11f T C 5: 86,537,999 S170G probably benign Het
Tnk2 T A 16: 32,680,465 D865E probably damaging Het
Ttll8 T C 15: 88,925,582 E337G probably benign Het
Ttn G A 2: 76,867,446 probably benign Het
Tubgcp6 T C 15: 89,106,291 E710G probably damaging Het
Txndc2 T A 17: 65,638,060 H374L probably benign Het
Unc80 G T 1: 66,674,732 probably null Het
Vmn2r23 G A 6: 123,733,349 C537Y probably damaging Het
Vmn2r45 A G 7: 8,483,117 F391L probably damaging Het
Vstm4 A T 14: 32,919,245 T262S probably benign Het
Zfp180 C T 7: 24,106,078 R641C probably damaging Het
Zfp979 A T 4: 147,613,914 S113T possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Zswim5 T A 4: 116,985,686 M876K possibly damaging Het
Other mutations in Pja2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Pja2 APN 17 64283531 missense probably damaging 1.00
IGL00945:Pja2 APN 17 64309396 missense probably benign 0.00
IGL01347:Pja2 APN 17 64313028 missense probably benign 0.34
IGL01831:Pja2 APN 17 64309407 missense probably benign 0.02
IGL01977:Pja2 APN 17 64297826 missense probably benign 0.02
IGL02812:Pja2 APN 17 64297794 missense probably damaging 1.00
H8441:Pja2 UTSW 17 64311197 missense probably damaging 1.00
R0062:Pja2 UTSW 17 64308971 missense probably damaging 1.00
R0062:Pja2 UTSW 17 64308971 missense probably damaging 1.00
R0411:Pja2 UTSW 17 64287521 splice site probably benign
R1240:Pja2 UTSW 17 64309618 missense probably benign 0.00
R1528:Pja2 UTSW 17 64309222 missense possibly damaging 0.75
R1996:Pja2 UTSW 17 64287644 critical splice acceptor site probably null
R2111:Pja2 UTSW 17 64290036 missense probably damaging 1.00
R2162:Pja2 UTSW 17 64309402 missense probably benign 0.00
R2201:Pja2 UTSW 17 64311167 splice site probably benign
R2276:Pja2 UTSW 17 64292870 missense probably damaging 1.00
R2278:Pja2 UTSW 17 64292870 missense probably damaging 1.00
R3831:Pja2 UTSW 17 64309402 missense probably benign 0.00
R3833:Pja2 UTSW 17 64309402 missense probably benign 0.00
R4598:Pja2 UTSW 17 64313030 start codon destroyed probably null 0.69
R4801:Pja2 UTSW 17 64292862 missense probably damaging 1.00
R4802:Pja2 UTSW 17 64292862 missense probably damaging 1.00
R5634:Pja2 UTSW 17 64292867 missense probably damaging 1.00
R5862:Pja2 UTSW 17 64297826 missense probably benign 0.02
R5905:Pja2 UTSW 17 64309090 missense probably benign 0.26
R6028:Pja2 UTSW 17 64309090 missense probably benign 0.26
R6382:Pja2 UTSW 17 64309615 missense probably benign 0.07
R6650:Pja2 UTSW 17 64292941 missense probably damaging 1.00
R6725:Pja2 UTSW 17 64289967 missense probably damaging 1.00
R6976:Pja2 UTSW 17 64308959 missense probably damaging 1.00
R7250:Pja2 UTSW 17 64309456 missense probably benign 0.01
R7389:Pja2 UTSW 17 64297727 missense probably damaging 1.00
R7477:Pja2 UTSW 17 64309645 missense possibly damaging 0.87
R7549:Pja2 UTSW 17 64309415 missense probably damaging 0.98
Z1176:Pja2 UTSW 17 64292869 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACGCTTCTCTGCTTAGC -3'
(R):5'- CAGAGATCTACGCTGACCTG -3'

Sequencing Primer
(F):5'- GCTTAGCCTCGTGCCTATTAAAAC -3'
(R):5'- CCTCTCTCAACGGTGAAATAAGTGAG -3'
Posted On2016-05-10