Incidental Mutation 'R4983:9130011E15Rik'
ID385774
Institutional Source Beutler Lab
Gene Symbol 9130011E15Rik
Ensembl Gene ENSMUSG00000039901
Gene NameRIKEN cDNA 9130011E15 gene
Synonyms
MMRRC Submission 042577-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4983 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location45818144-45998488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45950707 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 335 (T335A)
Ref Sequence ENSEMBL: ENSMUSP00000048454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045396]
Predicted Effect probably benign
Transcript: ENSMUST00000045396
AA Change: T335A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048454
Gene: ENSMUSG00000039901
AA Change: T335A

DomainStartEndE-ValueType
low complexity region 155 167 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
DUF1741 435 671 5.65e-139 SMART
Meta Mutation Damage Score 0.0586 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (103/106)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik T G 19: 42,053,076 S215R possibly damaging Het
Abcc9 T C 6: 142,682,141 M388V probably benign Het
Acbd6 A C 1: 155,601,529 T154P probably benign Het
Ago1 T C 4: 126,453,654 D434G probably damaging Het
Ankib1 A T 5: 3,769,652 M89K probably benign Het
Arap2 A T 5: 62,676,525 H866Q probably damaging Het
BC017158 C T 7: 128,276,473 probably benign Het
Capn12 A T 7: 28,890,370 H622L probably benign Het
Capns2 T G 8: 92,901,902 F140V probably damaging Het
Catsper1 T G 19: 5,335,963 F75V probably benign Het
Ccdc24 T C 4: 117,872,100 N16S probably benign Het
Cdkn2aip A T 8: 47,712,929 L114Q probably damaging Het
Cenpe T A 3: 135,234,928 S649R probably damaging Het
Chgb A T 2: 132,793,682 R515W probably damaging Het
Chrnb1 A G 11: 69,793,978 F123S probably damaging Het
Copz2 A T 11: 96,857,551 probably null Het
Cspp1 T A 1: 10,126,463 N900K probably damaging Het
Daw1 C A 1: 83,187,998 A178E probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epb41l5 T C 1: 119,555,071 D629G probably benign Het
Erap1 A G 13: 74,690,710 E925G probably benign Het
Exoc7 A C 11: 116,289,269 F657V probably damaging Het
Fam210b G C 2: 172,345,665 A2P probably damaging Homo
Fry A G 5: 150,398,254 E1018G probably damaging Het
Galc A T 12: 98,242,768 L15* probably null Het
Gm11232 T A 4: 71,756,901 K121N possibly damaging Het
Gm17677 T G 9: 35,742,169 F90V probably benign Het
Hectd1 A T 12: 51,784,262 D931E probably benign Het
Hecw2 T C 1: 53,832,671 H1372R probably benign Het
Ighv3-2 T A 12: 114,033,986 noncoding transcript Het
Kcns2 T G 15: 34,839,605 S371R probably damaging Het
Kif23 T C 9: 61,936,703 K175E probably benign Het
Kmt2c G A 5: 25,295,511 R436W possibly damaging Het
Lama5 A G 2: 180,193,449 S1317P probably benign Het
Lce1e T C 3: 92,707,828 S71G unknown Het
Lrrc37a T A 11: 103,497,618 E2327V unknown Het
Map3k20 A G 2: 72,402,067 M356V probably benign Het
Med12l C T 3: 59,261,929 A1580V probably damaging Het
Metap2 G T 10: 93,889,600 T30K possibly damaging Het
Mysm1 T A 4: 94,972,970 T53S probably benign Het
Nasp A T 4: 116,602,185 D717E probably damaging Het
Ndnf G A 6: 65,703,571 R278H possibly damaging Het
Neb A T 2: 52,216,261 N4205K probably damaging Het
Nebl A T 2: 17,375,271 I764N possibly damaging Het
Nucb1 A G 7: 45,498,889 Y131H probably damaging Het
Olfr1157 G T 2: 87,962,698 H65N probably benign Het
Olfr292 A C 7: 86,694,479 T8P probably benign Het
Olfr381 A G 11: 73,486,797 I9T probably benign Het
Oscp1 T A 4: 126,076,762 C115S probably benign Het
Paip2 C T 18: 35,613,359 R59C possibly damaging Het
Pcdhga4 G A 18: 37,686,519 D374N probably damaging Het
Pcolce G T 5: 137,605,674 probably benign Het
Pcyox1l T C 18: 61,699,397 E193G probably damaging Het
Pde6b A T 5: 108,425,330 Q522L probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phf11a A G 14: 59,284,438 F95L probably benign Het
Pja2 A C 17: 64,309,058 S281A probably benign Het
Plekhm2 A G 4: 141,634,376 F272S probably damaging Het
Pom121l2 T C 13: 21,983,814 S752P probably benign Het
Ppl T C 16: 5,088,718 T1238A possibly damaging Het
Prmt7 A G 8: 106,250,363 Y569C probably damaging Het
Prss37 G A 6: 40,516,136 T132I probably benign Het
Psmf1 A T 2: 151,729,457 probably benign Het
Ptprj A C 2: 90,460,532 I528S probably damaging Het
Reg1 A G 6: 78,428,213 T140A possibly damaging Het
Rtn4 A G 11: 29,707,217 N457S probably benign Het
Scn9a T C 2: 66,566,270 K93R probably benign Het
Sec16a A G 2: 26,439,519 V828A probably benign Het
Sec23b T A 2: 144,581,953 D507E probably benign Het
Sirt4 A T 5: 115,482,791 F107L probably benign Het
Slc14a2 A T 18: 78,150,401 L862Q probably damaging Het
Slc16a4 T C 3: 107,300,860 S229P probably benign Het
Slc37a3 A T 6: 39,352,717 C185* probably null Het
Slc5a2 A T 7: 128,271,810 *154C probably null Het
Snx17 A G 5: 31,195,794 S42G possibly damaging Het
Tgm6 T C 2: 130,141,193 V234A probably damaging Het
Thbs4 A G 13: 92,790,699 M94T probably benign Het
Thtpa A G 14: 55,072,148 probably benign Het
Tie1 T C 4: 118,483,755 E343G probably damaging Het
Tmem145 A G 7: 25,308,602 I238V probably benign Het
Tmprss11f T C 5: 86,537,999 S170G probably benign Het
Tnk2 T A 16: 32,680,465 D865E probably damaging Het
Ttll8 T C 15: 88,925,582 E337G probably benign Het
Ttn G A 2: 76,867,446 probably benign Het
Tubgcp6 T C 15: 89,106,291 E710G probably damaging Het
Txndc2 T A 17: 65,638,060 H374L probably benign Het
Unc80 G T 1: 66,674,732 probably null Het
Vmn2r23 G A 6: 123,733,349 C537Y probably damaging Het
Vmn2r45 A G 7: 8,483,117 F391L probably damaging Het
Vstm4 A T 14: 32,919,245 T262S probably benign Het
Zfp180 C T 7: 24,106,078 R641C probably damaging Het
Zfp979 A T 4: 147,613,914 S113T possibly damaging Het
Zswim4 C T 8: 84,226,667 probably null Het
Zswim5 T A 4: 116,985,686 M876K possibly damaging Het
Other mutations in 9130011E15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:9130011E15Rik APN 19 45940488 missense probably benign 0.19
IGL00788:9130011E15Rik APN 19 45932350 critical splice donor site probably null
IGL01356:9130011E15Rik APN 19 45966303 missense possibly damaging 0.94
IGL01477:9130011E15Rik APN 19 45978604 missense probably damaging 0.99
IGL01660:9130011E15Rik APN 19 45940476 missense probably damaging 1.00
IGL02193:9130011E15Rik APN 19 45972884 missense probably benign 0.02
IGL02863:9130011E15Rik APN 19 45958411 missense probably damaging 1.00
IGL03108:9130011E15Rik APN 19 45820353 missense probably damaging 0.99
R0035:9130011E15Rik UTSW 19 45891240 missense probably damaging 1.00
R0791:9130011E15Rik UTSW 19 45933868 splice site probably null
R0792:9130011E15Rik UTSW 19 45933868 splice site probably null
R1487:9130011E15Rik UTSW 19 45940443 critical splice donor site probably null
R1843:9130011E15Rik UTSW 19 45975252 missense probably benign 0.17
R2061:9130011E15Rik UTSW 19 45978667 missense probably damaging 1.00
R2070:9130011E15Rik UTSW 19 45891285 missense probably damaging 1.00
R2072:9130011E15Rik UTSW 19 45965381 missense probably damaging 0.99
R2073:9130011E15Rik UTSW 19 45965381 missense probably damaging 0.99
R2074:9130011E15Rik UTSW 19 45965381 missense probably damaging 0.99
R2091:9130011E15Rik UTSW 19 45952680 missense probably damaging 1.00
R2263:9130011E15Rik UTSW 19 45932349 critical splice donor site probably null
R2863:9130011E15Rik UTSW 19 45885957 missense probably damaging 1.00
R3236:9130011E15Rik UTSW 19 45975283 splice site probably benign
R3796:9130011E15Rik UTSW 19 45921610 splice site probably benign
R4044:9130011E15Rik UTSW 19 45820324 missense probably damaging 1.00
R4716:9130011E15Rik UTSW 19 45960342 missense probably damaging 1.00
R4974:9130011E15Rik UTSW 19 45820287 missense probably damaging 1.00
R5063:9130011E15Rik UTSW 19 45885955 missense possibly damaging 0.95
R5313:9130011E15Rik UTSW 19 45818975 missense probably damaging 1.00
R5782:9130011E15Rik UTSW 19 45886027 missense probably benign 0.08
R5985:9130011E15Rik UTSW 19 45820324 missense probably damaging 1.00
R6220:9130011E15Rik UTSW 19 45846115 missense possibly damaging 0.79
R6379:9130011E15Rik UTSW 19 45921697 missense possibly damaging 0.46
R6674:9130011E15Rik UTSW 19 45974998 missense probably benign 0.06
R6842:9130011E15Rik UTSW 19 45818977 missense probably benign 0.05
R6890:9130011E15Rik UTSW 19 45960357 missense probably damaging 1.00
R7034:9130011E15Rik UTSW 19 45965249 missense probably damaging 0.98
R7036:9130011E15Rik UTSW 19 45965249 missense probably damaging 0.98
R7305:9130011E15Rik UTSW 19 45892121 missense probably benign 0.35
R7411:9130011E15Rik UTSW 19 45965435 missense probably benign 0.00
R7762:9130011E15Rik UTSW 19 45940443 critical splice donor site probably null
R8021:9130011E15Rik UTSW 19 45956741 critical splice acceptor site probably null
R8366:9130011E15Rik UTSW 19 45932354 missense probably damaging 1.00
X0060:9130011E15Rik UTSW 19 45932393 missense possibly damaging 0.95
Z1088:9130011E15Rik UTSW 19 45818905 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTAACCCTGAGCGATC -3'
(R):5'- CATATAGGTCTGCAGGGAGC -3'

Sequencing Primer
(F):5'- CAGGCAGATCTCTGATTTTGAAGCC -3'
(R):5'- GAGCTGCCAGTCTCATTTTG -3'
Posted On2016-05-10