Incidental Mutation 'R4984:Olfr1256'
ID385777
Institutional Source Beutler Lab
Gene Symbol Olfr1256
Ensembl Gene ENSMUSG00000075073
Gene Nameolfactory receptor 1256
SynonymsGA_x6K02T2Q125-51276848-51275928, MOR231-1
MMRRC Submission 042578-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4984 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89825311-89841555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89835813 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 44 (V44D)
Ref Sequence ENSEMBL: ENSMUSP00000149123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099763] [ENSMUST00000111520] [ENSMUST00000213833] [ENSMUST00000215613]
Predicted Effect probably damaging
Transcript: ENSMUST00000099763
AA Change: V44D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097351
Gene: ENSMUSG00000075073
AA Change: V44D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 300 1.1e-5 PFAM
Pfam:7tm_1 39 285 5.3e-28 PFAM
Pfam:7tm_4 137 278 7.1e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111520
AA Change: V44D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107145
Gene: ENSMUSG00000075073
AA Change: V44D

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.1e-5 PFAM
Pfam:7tm_1 39 285 1.3e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213833
AA Change: V44D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000215613
AA Change: V44D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra2a T C 19: 54,046,639 I142T probably damaging Het
B020004J07Rik G C 4: 101,835,599 N401K possibly damaging Het
Cd109 T C 9: 78,634,677 probably null Het
Cdc42bpg T A 19: 6,316,223 I812N possibly damaging Het
Cftr A G 6: 18,235,199 E479G possibly damaging Het
Cpb1 GTTT GTT 3: 20,270,352 probably null Het
Crocc T C 4: 141,034,452 E873G probably damaging Het
Dnah3 C T 7: 119,928,779 V3827I probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
E230001N04Rik T C 17: 28,523,806 noncoding transcript Het
Gpr89 T A 3: 96,905,196 M10L probably benign Het
Kbtbd7 T C 14: 79,427,162 Y145H probably damaging Het
Kcnh8 T A 17: 52,877,967 Y426N probably damaging Het
Mipep A G 14: 60,788,182 D129G possibly damaging Het
Muc15 C T 2: 110,731,573 P118L probably damaging Het
Mug1 T C 6: 121,838,617 probably benign Het
Nubp1 T A 16: 10,421,244 D208E probably damaging Het
Olfr1192-ps1 A G 2: 88,412,577 L27P probably damaging Het
Olfr1286 A T 2: 111,420,847 Y35N probably damaging Het
Olfr229 A G 9: 39,910,610 D269G probably benign Het
Olfr651 T G 7: 104,553,021 I34S probably benign Het
Pdcd5 A C 7: 35,642,685 V166G probably damaging Het
Pde4d T C 13: 109,740,464 L173P probably damaging Het
Phldb2 T C 16: 45,825,633 Y195C probably damaging Het
Pifo T A 3: 106,001,494 probably benign Het
Pou4f1 T C 14: 104,466,183 E271G unknown Het
Ppl T C 16: 5,087,641 I1597V probably benign Het
Sorl1 C A 9: 41,991,342 D1640Y probably damaging Het
Taf4b T C 18: 14,835,816 L670P probably damaging Het
Tox3 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 8: 90,248,642 probably benign Het
Ttc39b A T 4: 83,242,209 I377K probably benign Het
Ttll3 A G 6: 113,412,940 D762G probably benign Het
Ubp1 T A 9: 113,959,392 I279K probably damaging Het
Vmn2r93 T A 17: 18,313,127 probably null Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Zfp644 A T 5: 106,636,917 L588Q possibly damaging Het
Other mutations in Olfr1256
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Olfr1256 APN 2 89835458 nonsense probably null
IGL01082:Olfr1256 APN 2 89844063 unclassified probably benign
IGL01613:Olfr1256 APN 2 89835808 missense probably damaging 0.98
IGL01969:Olfr1256 APN 2 89835720 missense probably benign 0.01
IGL02625:Olfr1256 APN 2 89835396 missense probably damaging 1.00
R0843:Olfr1256 UTSW 2 89835616 missense probably benign 0.01
R1270:Olfr1256 UTSW 2 89835322 missense possibly damaging 0.90
R1521:Olfr1256 UTSW 2 89835172 nonsense probably null
R2219:Olfr1256 UTSW 2 89835425 missense probably damaging 1.00
R2881:Olfr1256 UTSW 2 89844984 splice site probably null
R3121:Olfr1256 UTSW 2 89835514 missense probably benign
R3609:Olfr1256 UTSW 2 89835076 missense probably damaging 0.99
R5153:Olfr1256 UTSW 2 89835234 missense possibly damaging 0.77
R5640:Olfr1256 UTSW 2 89835938 missense probably benign 0.08
R7198:Olfr1256 UTSW 2 89835732 missense probably damaging 1.00
R7862:Olfr1256 UTSW 2 89835124 missense probably benign 0.16
R8100:Olfr1256 UTSW 2 89835685 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGGCCATCACCAGCAGAAG -3'
(R):5'- CACTGATATCATAATGCTCTGAGGAC -3'

Sequencing Primer
(F):5'- AAAGTGTTCTGTGAATAGCTGAGTC -3'
(R):5'- AATGCTCTGAGGACATTTTCTTTG -3'
Posted On2016-05-10