Incidental Mutation 'R4984:Muc15'
ID385778
Institutional Source Beutler Lab
Gene Symbol Muc15
Ensembl Gene ENSMUSG00000050808
Gene Namemucin 15
Synonyms
MMRRC Submission 042578-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4984 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location110721340-110739527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110731573 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 118 (P118L)
Ref Sequence ENSEMBL: ENSMUSP00000106646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090332] [ENSMUST00000099623] [ENSMUST00000111016] [ENSMUST00000111017] [ENSMUST00000140777]
Predicted Effect probably damaging
Transcript: ENSMUST00000090332
AA Change: P118L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087805
Gene: ENSMUSG00000050808
AA Change: P118L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Mucin15 21 331 2.3e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099623
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111016
AA Change: P118L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106645
Gene: ENSMUSG00000050808
AA Change: P118L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 93 108 N/A INTRINSIC
low complexity region 163 181 N/A INTRINSIC
transmembrane domain 235 257 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111017
AA Change: P118L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106646
Gene: ENSMUSG00000050808
AA Change: P118L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 93 108 N/A INTRINSIC
low complexity region 163 181 N/A INTRINSIC
transmembrane domain 235 257 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111019
SMART Domains Protein: ENSMUSP00000106648
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoctamin 384 627 6.3e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140777
SMART Domains Protein: ENSMUSP00000122387
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoctamin 40 141 5.7e-24 PFAM
Meta Mutation Damage Score 0.7416 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra2a T C 19: 54,046,639 I142T probably damaging Het
B020004J07Rik G C 4: 101,835,599 N401K possibly damaging Het
Cd109 T C 9: 78,634,677 probably null Het
Cdc42bpg T A 19: 6,316,223 I812N possibly damaging Het
Cftr A G 6: 18,235,199 E479G possibly damaging Het
Cpb1 GTTT GTT 3: 20,270,352 probably null Het
Crocc T C 4: 141,034,452 E873G probably damaging Het
Dnah3 C T 7: 119,928,779 V3827I probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
E230001N04Rik T C 17: 28,523,806 noncoding transcript Het
Gpr89 T A 3: 96,905,196 M10L probably benign Het
Kbtbd7 T C 14: 79,427,162 Y145H probably damaging Het
Kcnh8 T A 17: 52,877,967 Y426N probably damaging Het
Mipep A G 14: 60,788,182 D129G possibly damaging Het
Mug1 T C 6: 121,838,617 probably benign Het
Nubp1 T A 16: 10,421,244 D208E probably damaging Het
Olfr1192-ps1 A G 2: 88,412,577 L27P probably damaging Het
Olfr1256 A T 2: 89,835,813 V44D probably damaging Het
Olfr1286 A T 2: 111,420,847 Y35N probably damaging Het
Olfr229 A G 9: 39,910,610 D269G probably benign Het
Olfr651 T G 7: 104,553,021 I34S probably benign Het
Pdcd5 A C 7: 35,642,685 V166G probably damaging Het
Pde4d T C 13: 109,740,464 L173P probably damaging Het
Phldb2 T C 16: 45,825,633 Y195C probably damaging Het
Pifo T A 3: 106,001,494 probably benign Het
Pou4f1 T C 14: 104,466,183 E271G unknown Het
Ppl T C 16: 5,087,641 I1597V probably benign Het
Sorl1 C A 9: 41,991,342 D1640Y probably damaging Het
Taf4b T C 18: 14,835,816 L670P probably damaging Het
Tox3 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 8: 90,248,642 probably benign Het
Ttc39b A T 4: 83,242,209 I377K probably benign Het
Ttll3 A G 6: 113,412,940 D762G probably benign Het
Ubp1 T A 9: 113,959,392 I279K probably damaging Het
Vmn2r93 T A 17: 18,313,127 probably null Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Zfp644 A T 5: 106,636,917 L588Q possibly damaging Het
Other mutations in Muc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01978:Muc15 APN 2 110731596 missense probably benign 0.00
IGL02547:Muc15 APN 2 110731305 missense probably damaging 0.97
IGL02751:Muc15 APN 2 110731773 missense probably benign 0.14
IGL03100:Muc15 APN 2 110731594 missense probably damaging 0.99
IGL03188:Muc15 APN 2 110731699 missense probably benign 0.14
R0684:Muc15 UTSW 2 110733815 missense possibly damaging 0.95
R1472:Muc15 UTSW 2 110731560 missense probably damaging 1.00
R1582:Muc15 UTSW 2 110737472 missense probably benign 0.16
R1661:Muc15 UTSW 2 110733898 nonsense probably null
R1665:Muc15 UTSW 2 110733898 nonsense probably null
R1725:Muc15 UTSW 2 110731246 missense probably damaging 0.96
R1815:Muc15 UTSW 2 110731258 missense probably damaging 1.00
R1892:Muc15 UTSW 2 110737352 nonsense probably null
R2022:Muc15 UTSW 2 110731476 missense probably benign 0.00
R4546:Muc15 UTSW 2 110737499 missense probably damaging 0.97
R4953:Muc15 UTSW 2 110731272 missense probably damaging 0.99
R5858:Muc15 UTSW 2 110731798 missense probably damaging 1.00
R6046:Muc15 UTSW 2 110731441 nonsense probably null
R6695:Muc15 UTSW 2 110731271 missense probably damaging 1.00
R7468:Muc15 UTSW 2 110731517 missense probably benign 0.02
R7725:Muc15 UTSW 2 110731798 missense probably damaging 1.00
R8279:Muc15 UTSW 2 110731707 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAACTCCATTCATTTGGAAAGAAGC -3'
(R):5'- GTTCAGCTGTGAAAGGGGTC -3'

Sequencing Primer
(F):5'- CTTCAGAGAATGGAAGTGATATCTCC -3'
(R):5'- AAGGGGTCACAGGTGTGGTC -3'
Posted On2016-05-10