Incidental Mutation 'R4984:Olfr1286'
ID385779
Institutional Source Beutler Lab
Gene Symbol Olfr1286
Ensembl Gene ENSMUSG00000096703
Gene Nameolfactory receptor 1286
SynonymsMOR248-21, GA_x6K02T2Q125-72472405-72471488
MMRRC Submission 042578-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4984 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111417842-111423115 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111420847 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 35 (Y35N)
Ref Sequence ENSEMBL: ENSMUSP00000148932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099617] [ENSMUST00000184954] [ENSMUST00000213210]
Predicted Effect probably damaging
Transcript: ENSMUST00000099617
AA Change: Y35N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097212
Gene: ENSMUSG00000096703
AA Change: Y35N

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 3.4e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 301 3.4e-7 PFAM
Pfam:7tm_1 41 287 1.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184954
AA Change: Y35N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144852
Gene: ENSMUSG00000096703
AA Change: Y35N

DomainStartEndE-ValueType
Pfam:7tm_4 1 264 7.6e-38 PFAM
Pfam:7tm_1 5 251 7.2e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213210
AA Change: Y35N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.2643 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra2a T C 19: 54,046,639 I142T probably damaging Het
B020004J07Rik G C 4: 101,835,599 N401K possibly damaging Het
Cd109 T C 9: 78,634,677 probably null Het
Cdc42bpg T A 19: 6,316,223 I812N possibly damaging Het
Cftr A G 6: 18,235,199 E479G possibly damaging Het
Cpb1 GTTT GTT 3: 20,270,352 probably null Het
Crocc T C 4: 141,034,452 E873G probably damaging Het
Dnah3 C T 7: 119,928,779 V3827I probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
E230001N04Rik T C 17: 28,523,806 noncoding transcript Het
Gpr89 T A 3: 96,905,196 M10L probably benign Het
Kbtbd7 T C 14: 79,427,162 Y145H probably damaging Het
Kcnh8 T A 17: 52,877,967 Y426N probably damaging Het
Mipep A G 14: 60,788,182 D129G possibly damaging Het
Muc15 C T 2: 110,731,573 P118L probably damaging Het
Mug1 T C 6: 121,838,617 probably benign Het
Nubp1 T A 16: 10,421,244 D208E probably damaging Het
Olfr1192-ps1 A G 2: 88,412,577 L27P probably damaging Het
Olfr1256 A T 2: 89,835,813 V44D probably damaging Het
Olfr229 A G 9: 39,910,610 D269G probably benign Het
Olfr651 T G 7: 104,553,021 I34S probably benign Het
Pdcd5 A C 7: 35,642,685 V166G probably damaging Het
Pde4d T C 13: 109,740,464 L173P probably damaging Het
Phldb2 T C 16: 45,825,633 Y195C probably damaging Het
Pifo T A 3: 106,001,494 probably benign Het
Pou4f1 T C 14: 104,466,183 E271G unknown Het
Ppl T C 16: 5,087,641 I1597V probably benign Het
Sorl1 C A 9: 41,991,342 D1640Y probably damaging Het
Taf4b T C 18: 14,835,816 L670P probably damaging Het
Tox3 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 8: 90,248,642 probably benign Het
Ttc39b A T 4: 83,242,209 I377K probably benign Het
Ttll3 A G 6: 113,412,940 D762G probably benign Het
Ubp1 T A 9: 113,959,392 I279K probably damaging Het
Vmn2r93 T A 17: 18,313,127 probably null Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Zfp644 A T 5: 106,636,917 L588Q possibly damaging Het
Other mutations in Olfr1286
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Olfr1286 APN 2 111420892 missense probably benign 0.04
IGL01953:Olfr1286 APN 2 111420312 missense probably benign 0.22
IGL02251:Olfr1286 APN 2 111420312 missense probably damaging 0.99
IGL02514:Olfr1286 APN 2 111420772 missense probably damaging 1.00
IGL02868:Olfr1286 APN 2 111420493 missense possibly damaging 0.55
PIT4403001:Olfr1286 UTSW 2 111420820 missense probably benign 0.00
R0630:Olfr1286 UTSW 2 111420846 missense probably damaging 1.00
R1442:Olfr1286 UTSW 2 111420093 missense probably damaging 1.00
R1712:Olfr1286 UTSW 2 111420658 missense probably benign 0.22
R2510:Olfr1286 UTSW 2 111420451 missense possibly damaging 0.74
R4399:Olfr1286 UTSW 2 111420799 missense probably benign 0.00
R5186:Olfr1286 UTSW 2 111420774 missense probably damaging 1.00
R6044:Olfr1286 UTSW 2 111420078 missense probably damaging 1.00
R6107:Olfr1286 UTSW 2 111420655 missense probably benign 0.01
R6372:Olfr1286 UTSW 2 111420802 missense probably benign 0.12
R7230:Olfr1286 UTSW 2 111420916 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCTGGCTCATACACCCTACAAAG -3'
(R):5'- AAATGTGGGCTGGATAAGTTGC -3'

Sequencing Primer
(F):5'- TGGTTACTGAGCAAAGGC -3'
(R):5'- TCAGGAGTCTTTGGTTCAACTC -3'
Posted On2016-05-10