Incidental Mutation 'R4984:Olfr651'
ID385789
Institutional Source Beutler Lab
Gene Symbol Olfr651
Ensembl Gene ENSMUSG00000073928
Gene Nameolfactory receptor 651
SynonymsGA_x6K02T2PBJ9-7179540-7180481, MOR31-11
MMRRC Submission 042578-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4984 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104550133-104554422 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 104553021 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 34 (I34S)
Ref Sequence ENSEMBL: ENSMUSP00000150776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098176] [ENSMUST00000216904]
Predicted Effect probably benign
Transcript: ENSMUST00000098176
AA Change: I34S

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095778
Gene: ENSMUSG00000073928
AA Change: I34S

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 4.1e-104 PFAM
Pfam:7TM_GPCR_Srsx 35 303 1e-10 PFAM
Pfam:7tm_1 41 292 4.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216246
Predicted Effect probably benign
Transcript: ENSMUST00000216904
AA Change: I34S

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra2a T C 19: 54,046,639 I142T probably damaging Het
B020004J07Rik G C 4: 101,835,599 N401K possibly damaging Het
Cd109 T C 9: 78,634,677 probably null Het
Cdc42bpg T A 19: 6,316,223 I812N possibly damaging Het
Cftr A G 6: 18,235,199 E479G possibly damaging Het
Cpb1 GTTT GTT 3: 20,270,352 probably null Het
Crocc T C 4: 141,034,452 E873G probably damaging Het
Dnah3 C T 7: 119,928,779 V3827I probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
E230001N04Rik T C 17: 28,523,806 noncoding transcript Het
Gpr89 T A 3: 96,905,196 M10L probably benign Het
Kbtbd7 T C 14: 79,427,162 Y145H probably damaging Het
Kcnh8 T A 17: 52,877,967 Y426N probably damaging Het
Mipep A G 14: 60,788,182 D129G possibly damaging Het
Muc15 C T 2: 110,731,573 P118L probably damaging Het
Mug1 T C 6: 121,838,617 probably benign Het
Nubp1 T A 16: 10,421,244 D208E probably damaging Het
Olfr1192-ps1 A G 2: 88,412,577 L27P probably damaging Het
Olfr1256 A T 2: 89,835,813 V44D probably damaging Het
Olfr1286 A T 2: 111,420,847 Y35N probably damaging Het
Olfr229 A G 9: 39,910,610 D269G probably benign Het
Pdcd5 A C 7: 35,642,685 V166G probably damaging Het
Pde4d T C 13: 109,740,464 L173P probably damaging Het
Phldb2 T C 16: 45,825,633 Y195C probably damaging Het
Pifo T A 3: 106,001,494 probably benign Het
Pou4f1 T C 14: 104,466,183 E271G unknown Het
Ppl T C 16: 5,087,641 I1597V probably benign Het
Sorl1 C A 9: 41,991,342 D1640Y probably damaging Het
Taf4b T C 18: 14,835,816 L670P probably damaging Het
Tox3 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 8: 90,248,642 probably benign Het
Ttc39b A T 4: 83,242,209 I377K probably benign Het
Ttll3 A G 6: 113,412,940 D762G probably benign Het
Ubp1 T A 9: 113,959,392 I279K probably damaging Het
Vmn2r93 T A 17: 18,313,127 probably null Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Zfp644 A T 5: 106,636,917 L588Q possibly damaging Het
Other mutations in Olfr651
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Olfr651 APN 7 104553092 missense probably benign 0.18
IGL01120:Olfr651 APN 7 104553345 missense probably benign
IGL01325:Olfr651 APN 7 104553689 missense probably damaging 1.00
IGL01590:Olfr651 APN 7 104553575 missense probably benign 0.00
IGL02625:Olfr651 APN 7 104553573 missense probably damaging 1.00
IGL02685:Olfr651 APN 7 104553150 missense probably benign 0.35
P0157:Olfr651 UTSW 7 104553507 missense probably damaging 1.00
R0087:Olfr651 UTSW 7 104553662 missense possibly damaging 0.73
R0399:Olfr651 UTSW 7 104553369 missense probably benign 0.05
R0547:Olfr651 UTSW 7 104553356 missense probably benign 0.01
R0630:Olfr651 UTSW 7 104553791 missense probably benign 0.27
R1014:Olfr651 UTSW 7 104553176 missense probably damaging 1.00
R1127:Olfr651 UTSW 7 104553086 missense possibly damaging 0.94
R1724:Olfr651 UTSW 7 104553228 missense probably damaging 1.00
R2473:Olfr651 UTSW 7 104552939 missense possibly damaging 0.93
R3115:Olfr651 UTSW 7 104553088 missense probably benign 0.13
R3116:Olfr651 UTSW 7 104553088 missense probably benign 0.13
R3834:Olfr651 UTSW 7 104553345 missense probably benign 0.43
R4027:Olfr651 UTSW 7 104553323 missense possibly damaging 0.90
R4423:Olfr651 UTSW 7 104553345 missense probably benign
R4907:Olfr651 UTSW 7 104553311 missense probably damaging 0.97
R5266:Olfr651 UTSW 7 104553819 missense probably benign 0.00
R5592:Olfr651 UTSW 7 104553731 missense probably benign 0.28
R6441:Olfr651 UTSW 7 104553335 nonsense probably null
R7463:Olfr651 UTSW 7 104553482 missense possibly damaging 0.88
R7647:Olfr651 UTSW 7 104553686 missense probably benign 0.00
R8276:Olfr651 UTSW 7 104553315 missense probably damaging 1.00
X0067:Olfr651 UTSW 7 104553387 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GAATTGTCACCAGTCCTCTGC -3'
(R):5'- CATCTGAGTGAGACAACCAGAG -3'

Sequencing Primer
(F):5'- TCTGCACCCAGAGTTGAACATTTAC -3'
(R):5'- GAAGGTTATTTCTTGGGACCCAAACC -3'
Posted On2016-05-10