Incidental Mutation 'R4985:Olfr913'
ID385832
Institutional Source Beutler Lab
Gene Symbol Olfr913
Ensembl Gene ENSMUSG00000059189
Gene Nameolfactory receptor 913
SynonymsMOR165-9P, GA_x6K02T2PVTD-32296575-32297513, MOR165-10
MMRRC Submission 042579-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R4985 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38592759-38596283 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38594362 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 47 (I47N)
Ref Sequence ENSEMBL: ENSMUSP00000079876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081095]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081095
AA Change: I47N

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079876
Gene: ENSMUSG00000059189
AA Change: I47N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-49 PFAM
Pfam:7tm_1 41 290 3.9e-23 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921508M14Rik A T 12: 34,874,458 probably benign Het
Actn4 A G 7: 28,918,986 L83P probably damaging Het
Adgb T C 10: 10,400,632 R331G possibly damaging Het
Arntl T C 7: 113,285,073 V106A probably damaging Het
Brf1 G T 12: 112,969,370 probably null Het
Cd248 C T 19: 5,069,792 T556I probably damaging Het
Cdkn2aip G T 8: 47,713,445 probably benign Het
Ces1d T C 8: 93,175,144 E399G possibly damaging Het
Col9a3 G A 2: 180,603,400 R134H unknown Het
Ddb2 T C 2: 91,212,298 probably null Het
Dlg1 A G 16: 31,788,135 probably null Het
Dnah1 T G 14: 31,286,898 E1973A probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
E130308A19Rik A G 4: 59,691,017 T284A probably benign Het
Ecm1 C T 3: 95,736,103 R295H possibly damaging Het
Efcab5 T A 11: 77,138,229 H92L probably damaging Het
Egfr C A 11: 16,859,029 Y74* probably null Het
Fbxo10 T C 4: 45,040,692 I838V probably benign Het
Gfod2 C T 8: 105,728,011 R79Q probably damaging Het
Gm11568 C A 11: 99,858,448 P160T unknown Het
Gm29106 A T 1: 118,199,220 D214V probably benign Het
Htr3b C A 9: 48,935,941 V425F possibly damaging Het
Krt86 A T 15: 101,477,265 E347V probably damaging Het
Lamc2 T C 1: 153,136,805 I708V probably benign Het
Ldb2 T A 5: 44,480,303 K221I probably damaging Het
Lmntd2 A C 7: 141,213,277 S127R probably benign Het
Lrba A G 3: 86,327,436 probably null Het
Mettl26 T A 17: 25,876,776 *202R probably null Het
Mmp24 A G 2: 155,814,096 K485E probably damaging Het
Nap1l1 T C 10: 111,490,083 C88R probably benign Het
Olfr715 C A 7: 107,129,027 R122L probably damaging Het
Pafah1b1 T G 11: 74,685,988 D159A probably damaging Het
Pcdhga7 T C 18: 37,715,645 V235A probably benign Het
Pcf11 T C 7: 92,661,902 T293A probably benign Het
Pidd1 A C 7: 141,438,591 *916E probably null Het
Pip4k2c T C 10: 127,199,375 I375V probably benign Het
Pou3f2 A T 4: 22,487,588 S182T probably benign Het
Rin3 A T 12: 102,368,562 D164V unknown Het
Rnf8 T C 17: 29,626,860 S199P possibly damaging Het
Serpina6 A G 12: 103,653,936 S185P probably benign Het
Slc47a2 C A 11: 61,302,233 V565L probably benign Het
Slfn4 T A 11: 83,187,207 F274I probably damaging Het
Tgif1 T C 17: 70,844,872 Y248C probably benign Het
Tlx1 C A 19: 45,150,982 Q23K possibly damaging Het
Trpv4 T C 5: 114,622,732 D846G probably benign Het
Tspyl1 G A 10: 34,282,338 D20N probably benign Het
Vmn1r159 A T 7: 22,843,534 F24L probably damaging Het
Vmn1r204 T A 13: 22,557,060 V287D probably damaging Het
Zdhhc18 A G 4: 133,612,917 probably null Het
Zfp276 T G 8: 123,267,907 V571G probably damaging Het
Other mutations in Olfr913
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Olfr913 APN 9 38594905 missense probably damaging 0.98
IGL02028:Olfr913 APN 9 38594419 nonsense probably null
IGL02256:Olfr913 APN 9 38594544 missense probably benign 0.01
IGL03103:Olfr913 APN 9 38594527 missense probably damaging 1.00
IGL03297:Olfr913 APN 9 38594525 missense probably benign 0.01
R2152:Olfr913 UTSW 9 38594411 missense probably damaging 1.00
R2153:Olfr913 UTSW 9 38594411 missense probably damaging 1.00
R2154:Olfr913 UTSW 9 38594411 missense probably damaging 1.00
R3176:Olfr913 UTSW 9 38594643 missense probably damaging 1.00
R3276:Olfr913 UTSW 9 38594643 missense probably damaging 1.00
R5043:Olfr913 UTSW 9 38594841 missense probably damaging 1.00
R5871:Olfr913 UTSW 9 38594332 missense possibly damaging 0.53
R6106:Olfr913 UTSW 9 38594956 missense probably benign 0.11
R6583:Olfr913 UTSW 9 38594964 missense possibly damaging 0.79
R6823:Olfr913 UTSW 9 38594905 missense possibly damaging 0.89
R7472:Olfr913 UTSW 9 38594904 missense probably benign 0.10
R7912:Olfr913 UTSW 9 38595150 missense probably benign 0.25
R8036:Olfr913 UTSW 9 38594890 missense probably benign 0.00
R8182:Olfr913 UTSW 9 38594544 missense probably benign 0.01
R8390:Olfr913 UTSW 9 38594591 nonsense probably null
Z1177:Olfr913 UTSW 9 38594289 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATGAAAGGCTGGTTCAAAG -3'
(R):5'- TTGAGGTCAGCACATAACACTC -3'

Sequencing Primer
(F):5'- CATGAAAGGCTGGTTCAAAGAATTTG -3'
(R):5'- GGTCAGCACATAACACTCAGAAATG -3'
Posted On2016-05-10