Mutagenetix > Incidental Mutations

Incidental Mutation 'R4985:Nap1l1'

385837

Institutional Source

Beutler Lab

Gene Symbol

Nap1l1

Ensembl Gene

ENSMUSG00000058799

Gene Name

nucleosome assembly protein 1-like 1

Synonyms

D10Ertd68e

MMRRC Submission

042579-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.289) question?

Stock #

R4985 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

111473223-111498150 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 111490083 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 88 (C88R)

Ref Sequence

ENSEMBL: ENSMUSP00000151507 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065917] [ENSMUST00000171797] [ENSMUST00000217908] [ENSMUST00000218828] [ENSMUST00000219143] [ENSMUST00000219961]

AlphaFold

P28656

Predicted Effect

probably benign
Transcript: ENSMUST00000065917
AA Change: C88R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000070068
Gene: ENSMUSG00000058799
AA Change: C88R

Domain	Start	End	E-Value	Type
coiled coil region	6	31	N/A	INTRINSIC
Pfam:NAP	75	346	1.5e-96	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171797
AA Change: C115R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000126850
Gene: ENSMUSG00000058799
AA Change: C115R

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
coiled coil region	33	58	N/A	INTRINSIC
Pfam:NAP	103	372	9.6e-110	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000217908
AA Change: C88R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

Predicted Effect

probably benign
Transcript: ENSMUST00000218828
AA Change: C88R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218982

Predicted Effect

probably benign
Transcript: ENSMUST00000219143
AA Change: C88R

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219718

Predicted Effect

probably benign
Transcript: ENSMUST00000219961
AA Change: C88R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

Meta Mutation Damage Score

0.4401

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleosome assembly protein (NAP) family. This protein participates in DNA replication and may play a role in modulating chromatin formation and contribute to the regulation of cell proliferation. Alternative splicing results in multiple transcript variants encoding different isoforms; however, not all have been fully described. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921508M14Rik	A	T	12: 34,874,458		probably benign	Het
Actn4	A	G	7: 28,918,986	L83P	probably damaging	Het
Adgb	T	C	10: 10,400,632	R331G	possibly damaging	Het
Arntl	T	C	7: 113,285,073	V106A	probably damaging	Het
Brf1	G	T	12: 112,969,370		probably null	Het
Cd248	C	T	19: 5,069,792	T556I	probably damaging	Het
Cdkn2aip	G	T	8: 47,713,445		probably benign	Het
Ces1d	T	C	8: 93,175,144	E399G	possibly damaging	Het
Col9a3	G	A	2: 180,603,400	R134H	unknown	Het
Ddb2	T	C	2: 91,212,298		probably null	Het
Dlg1	A	G	16: 31,788,135		probably null	Het
Dnah1	T	G	14: 31,286,898	E1973A	probably null	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
E130308A19Rik	A	G	4: 59,691,017	T284A	probably benign	Het
Ecm1	C	T	3: 95,736,103	R295H	possibly damaging	Het
Efcab5	T	A	11: 77,138,229	H92L	probably damaging	Het
Egfr	C	A	11: 16,859,029	Y74*	probably null	Het
Fbxo10	T	C	4: 45,040,692	I838V	probably benign	Het
Gfod2	C	T	8: 105,728,011	R79Q	probably damaging	Het
Gm11568	C	A	11: 99,858,448	P160T	unknown	Het
Gm29106	A	T	1: 118,199,220	D214V	probably benign	Het
Htr3b	C	A	9: 48,935,941	V425F	possibly damaging	Het
Krt86	A	T	15: 101,477,265	E347V	probably damaging	Het
Lamc2	T	C	1: 153,136,805	I708V	probably benign	Het
Ldb2	T	A	5: 44,480,303	K221I	probably damaging	Het
Lmntd2	A	C	7: 141,213,277	S127R	probably benign	Het
Lrba	A	G	3: 86,327,436		probably null	Het
Mettl26	T	A	17: 25,876,776	*202R	probably null	Het
Mmp24	A	G	2: 155,814,096	K485E	probably damaging	Het
Olfr715	C	A	7: 107,129,027	R122L	probably damaging	Het
Olfr913	T	A	9: 38,594,362	I47N	possibly damaging	Het
Pafah1b1	T	G	11: 74,685,988	D159A	probably damaging	Het
Pcdhga7	T	C	18: 37,715,645	V235A	probably benign	Het
Pcf11	T	C	7: 92,661,902	T293A	probably benign	Het
Pidd1	A	C	7: 141,438,591	*916E	probably null	Het
Pip4k2c	T	C	10: 127,199,375	I375V	probably benign	Het
Pou3f2	A	T	4: 22,487,588	S182T	probably benign	Het
Rin3	A	T	12: 102,368,562	D164V	unknown	Het
Rnf8	T	C	17: 29,626,860	S199P	possibly damaging	Het
Serpina6	A	G	12: 103,653,936	S185P	probably benign	Het
Slc47a2	C	A	11: 61,302,233	V565L	probably benign	Het
Slfn4	T	A	11: 83,187,207	F274I	probably damaging	Het
Tgif1	T	C	17: 70,844,872	Y248C	probably benign	Het
Tlx1	C	A	19: 45,150,982	Q23K	possibly damaging	Het
Trpv4	T	C	5: 114,622,732	D846G	probably benign	Het
Tspyl1	G	A	10: 34,282,338	D20N	probably benign	Het
Vmn1r159	A	T	7: 22,843,534	F24L	probably damaging	Het
Vmn1r204	T	A	13: 22,557,060	V287D	probably damaging	Het
Zdhhc18	A	G	4: 133,612,917		probably null	Het
Zfp276	T	G	8: 123,267,907	V571G	probably damaging	Het

Other mutations in Nap1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01154:Nap1l1	APN	10	111486675	missense	probably damaging	0.98
IGL01453:Nap1l1	APN	10	111492978	missense	probably benign	0.09
IGL01734:Nap1l1	APN	10	111492899	missense	probably benign	0.26
IGL01843:Nap1l1	APN	10	111492911	missense	possibly damaging	0.93
PIT1430001:Nap1l1	UTSW	10	111486736	missense	probably damaging	1.00
PIT4131001:Nap1l1	UTSW	10	111486722	missense	probably null
R0020:Nap1l1	UTSW	10	111491023	missense	probably benign	0.01
R0020:Nap1l1	UTSW	10	111491023	missense	probably benign	0.01
R0131:Nap1l1	UTSW	10	111485509	missense	probably benign	0.17
R0131:Nap1l1	UTSW	10	111485509	missense	probably benign	0.17
R0132:Nap1l1	UTSW	10	111485509	missense	probably benign	0.17
R0601:Nap1l1	UTSW	10	111490363	splice site	probably benign
R1576:Nap1l1	UTSW	10	111494820	missense	probably damaging	1.00
R1619:Nap1l1	UTSW	10	111493379	missense	possibly damaging	0.77
R1969:Nap1l1	UTSW	10	111491053	missense	probably benign	0.03
R2071:Nap1l1	UTSW	10	111492900	missense	possibly damaging	0.46
R2383:Nap1l1	UTSW	10	111493411	missense	probably damaging	1.00
R3836:Nap1l1	UTSW	10	111495322	splice site	probably null
R3837:Nap1l1	UTSW	10	111495322	splice site	probably null
R3838:Nap1l1	UTSW	10	111495322	splice site	probably null
R3839:Nap1l1	UTSW	10	111495322	splice site	probably null
R4084:Nap1l1	UTSW	10	111490077	missense	possibly damaging	0.92
R4609:Nap1l1	UTSW	10	111492880	nonsense	probably null
R5906:Nap1l1	UTSW	10	111491030	nonsense	probably null
R5982:Nap1l1	UTSW	10	111495368	missense	possibly damaging	0.71
R6522:Nap1l1	UTSW	10	111494223	missense	probably damaging	0.99
R6868:Nap1l1	UTSW	10	111494808	missense	probably damaging	1.00
R7134:Nap1l1	UTSW	10	111494794	critical splice acceptor site	probably null
R7202:Nap1l1	UTSW	10	111491103	missense	probably damaging	1.00
R7789:Nap1l1	UTSW	10	111490456	missense	probably benign	0.01
R7950:Nap1l1	UTSW	10	111492908	missense	probably damaging	1.00
R8404:Nap1l1	UTSW	10	111481301	start codon destroyed	probably null	0.53
R8502:Nap1l1	UTSW	10	111481301	start codon destroyed	probably null	0.53
R8933:Nap1l1	UTSW	10	111492849	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- ATTCAACCTGGCTTAAGGGTATTTC -3'
(R):5'- TTAATCCTGGCCACTGCTGC -3'

Sequencing Primer
(F):5'- AACCTGGCTTAAGGGTATTTCTTGTG -3'
(R):5'- GCTGCTCTCAGACACCTCTAATAC -3'

Posted On

2016-05-10