Incidental Mutation 'R4985:Nap1l1'
ID 385837
Institutional Source Beutler Lab
Gene Symbol Nap1l1
Ensembl Gene ENSMUSG00000058799
Gene Name nucleosome assembly protein 1-like 1
Synonyms D10Ertd68e
MMRRC Submission 042579-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock # R4985 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 111473223-111498150 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 111490083 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 88 (C88R)
Ref Sequence ENSEMBL: ENSMUSP00000151507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065917] [ENSMUST00000171797] [ENSMUST00000217908] [ENSMUST00000218828] [ENSMUST00000219143] [ENSMUST00000219961]
AlphaFold P28656
Predicted Effect probably benign
Transcript: ENSMUST00000065917
AA Change: C88R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000070068
Gene: ENSMUSG00000058799
AA Change: C88R

DomainStartEndE-ValueType
coiled coil region 6 31 N/A INTRINSIC
Pfam:NAP 75 346 1.5e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171797
AA Change: C115R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000126850
Gene: ENSMUSG00000058799
AA Change: C115R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
coiled coil region 33 58 N/A INTRINSIC
Pfam:NAP 103 372 9.6e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217908
AA Change: C88R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000218828
AA Change: C88R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218982
Predicted Effect probably benign
Transcript: ENSMUST00000219143
AA Change: C88R

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219718
Predicted Effect probably benign
Transcript: ENSMUST00000219961
AA Change: C88R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.4401 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleosome assembly protein (NAP) family. This protein participates in DNA replication and may play a role in modulating chromatin formation and contribute to the regulation of cell proliferation. Alternative splicing results in multiple transcript variants encoding different isoforms; however, not all have been fully described. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921508M14Rik A T 12: 34,874,458 probably benign Het
Actn4 A G 7: 28,918,986 L83P probably damaging Het
Adgb T C 10: 10,400,632 R331G possibly damaging Het
Arntl T C 7: 113,285,073 V106A probably damaging Het
Brf1 G T 12: 112,969,370 probably null Het
Cd248 C T 19: 5,069,792 T556I probably damaging Het
Cdkn2aip G T 8: 47,713,445 probably benign Het
Ces1d T C 8: 93,175,144 E399G possibly damaging Het
Col9a3 G A 2: 180,603,400 R134H unknown Het
Ddb2 T C 2: 91,212,298 probably null Het
Dlg1 A G 16: 31,788,135 probably null Het
Dnah1 T G 14: 31,286,898 E1973A probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
E130308A19Rik A G 4: 59,691,017 T284A probably benign Het
Ecm1 C T 3: 95,736,103 R295H possibly damaging Het
Efcab5 T A 11: 77,138,229 H92L probably damaging Het
Egfr C A 11: 16,859,029 Y74* probably null Het
Fbxo10 T C 4: 45,040,692 I838V probably benign Het
Gfod2 C T 8: 105,728,011 R79Q probably damaging Het
Gm11568 C A 11: 99,858,448 P160T unknown Het
Gm29106 A T 1: 118,199,220 D214V probably benign Het
Htr3b C A 9: 48,935,941 V425F possibly damaging Het
Krt86 A T 15: 101,477,265 E347V probably damaging Het
Lamc2 T C 1: 153,136,805 I708V probably benign Het
Ldb2 T A 5: 44,480,303 K221I probably damaging Het
Lmntd2 A C 7: 141,213,277 S127R probably benign Het
Lrba A G 3: 86,327,436 probably null Het
Mettl26 T A 17: 25,876,776 *202R probably null Het
Mmp24 A G 2: 155,814,096 K485E probably damaging Het
Olfr715 C A 7: 107,129,027 R122L probably damaging Het
Olfr913 T A 9: 38,594,362 I47N possibly damaging Het
Pafah1b1 T G 11: 74,685,988 D159A probably damaging Het
Pcdhga7 T C 18: 37,715,645 V235A probably benign Het
Pcf11 T C 7: 92,661,902 T293A probably benign Het
Pidd1 A C 7: 141,438,591 *916E probably null Het
Pip4k2c T C 10: 127,199,375 I375V probably benign Het
Pou3f2 A T 4: 22,487,588 S182T probably benign Het
Rin3 A T 12: 102,368,562 D164V unknown Het
Rnf8 T C 17: 29,626,860 S199P possibly damaging Het
Serpina6 A G 12: 103,653,936 S185P probably benign Het
Slc47a2 C A 11: 61,302,233 V565L probably benign Het
Slfn4 T A 11: 83,187,207 F274I probably damaging Het
Tgif1 T C 17: 70,844,872 Y248C probably benign Het
Tlx1 C A 19: 45,150,982 Q23K possibly damaging Het
Trpv4 T C 5: 114,622,732 D846G probably benign Het
Tspyl1 G A 10: 34,282,338 D20N probably benign Het
Vmn1r159 A T 7: 22,843,534 F24L probably damaging Het
Vmn1r204 T A 13: 22,557,060 V287D probably damaging Het
Zdhhc18 A G 4: 133,612,917 probably null Het
Zfp276 T G 8: 123,267,907 V571G probably damaging Het
Other mutations in Nap1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Nap1l1 APN 10 111486675 missense probably damaging 0.98
IGL01453:Nap1l1 APN 10 111492978 missense probably benign 0.09
IGL01734:Nap1l1 APN 10 111492899 missense probably benign 0.26
IGL01843:Nap1l1 APN 10 111492911 missense possibly damaging 0.93
PIT1430001:Nap1l1 UTSW 10 111486736 missense probably damaging 1.00
PIT4131001:Nap1l1 UTSW 10 111486722 missense probably null
R0020:Nap1l1 UTSW 10 111491023 missense probably benign 0.01
R0020:Nap1l1 UTSW 10 111491023 missense probably benign 0.01
R0131:Nap1l1 UTSW 10 111485509 missense probably benign 0.17
R0131:Nap1l1 UTSW 10 111485509 missense probably benign 0.17
R0132:Nap1l1 UTSW 10 111485509 missense probably benign 0.17
R0601:Nap1l1 UTSW 10 111490363 splice site probably benign
R1576:Nap1l1 UTSW 10 111494820 missense probably damaging 1.00
R1619:Nap1l1 UTSW 10 111493379 missense possibly damaging 0.77
R1969:Nap1l1 UTSW 10 111491053 missense probably benign 0.03
R2071:Nap1l1 UTSW 10 111492900 missense possibly damaging 0.46
R2383:Nap1l1 UTSW 10 111493411 missense probably damaging 1.00
R3836:Nap1l1 UTSW 10 111495322 splice site probably null
R3837:Nap1l1 UTSW 10 111495322 splice site probably null
R3838:Nap1l1 UTSW 10 111495322 splice site probably null
R3839:Nap1l1 UTSW 10 111495322 splice site probably null
R4084:Nap1l1 UTSW 10 111490077 missense possibly damaging 0.92
R4609:Nap1l1 UTSW 10 111492880 nonsense probably null
R5906:Nap1l1 UTSW 10 111491030 nonsense probably null
R5982:Nap1l1 UTSW 10 111495368 missense possibly damaging 0.71
R6522:Nap1l1 UTSW 10 111494223 missense probably damaging 0.99
R6868:Nap1l1 UTSW 10 111494808 missense probably damaging 1.00
R7134:Nap1l1 UTSW 10 111494794 critical splice acceptor site probably null
R7202:Nap1l1 UTSW 10 111491103 missense probably damaging 1.00
R7789:Nap1l1 UTSW 10 111490456 missense probably benign 0.01
R7950:Nap1l1 UTSW 10 111492908 missense probably damaging 1.00
R8404:Nap1l1 UTSW 10 111481301 start codon destroyed probably null 0.53
R8502:Nap1l1 UTSW 10 111481301 start codon destroyed probably null 0.53
R8933:Nap1l1 UTSW 10 111492849 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATTCAACCTGGCTTAAGGGTATTTC -3'
(R):5'- TTAATCCTGGCCACTGCTGC -3'

Sequencing Primer
(F):5'- AACCTGGCTTAAGGGTATTTCTTGTG -3'
(R):5'- GCTGCTCTCAGACACCTCTAATAC -3'
Posted On 2016-05-10