Incidental Mutation 'R4985:Krt86'
ID385852
Institutional Source Beutler Lab
Gene Symbol Krt86
Ensembl Gene ENSMUSG00000067614
Gene Namekeratin 86
SynonymsKrt2-10, Khb4, Krt2-11, MHb4
MMRRC Submission 042579-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4985 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101473478-101479986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101477265 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 347 (E347V)
Ref Sequence ENSEMBL: ENSMUSP00000085365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088049]
Predicted Effect probably damaging
Transcript: ENSMUST00000088049
AA Change: E347V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000085365
Gene: ENSMUSG00000067614
AA Change: E347V

DomainStartEndE-ValueType
Pfam:Keratin_2_head 2 102 4.6e-15 PFAM
Filament 105 416 6.92e-148 SMART
low complexity region 420 438 N/A INTRINSIC
low complexity region 469 486 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230173
Meta Mutation Damage Score 0.7977 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II keratin protein, which heterodimerizes with type I keratins to form hair and nails. This gene is present in a cluster of related genes and pseudogenes on chromosome 12. Mutations in this gene have been observed in patients with the hair disease monilethrix. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921508M14Rik A T 12: 34,874,458 probably benign Het
Actn4 A G 7: 28,918,986 L83P probably damaging Het
Adgb T C 10: 10,400,632 R331G possibly damaging Het
Arntl T C 7: 113,285,073 V106A probably damaging Het
Brf1 G T 12: 112,969,370 probably null Het
Cd248 C T 19: 5,069,792 T556I probably damaging Het
Cdkn2aip G T 8: 47,713,445 probably benign Het
Ces1d T C 8: 93,175,144 E399G possibly damaging Het
Col9a3 G A 2: 180,603,400 R134H unknown Het
Ddb2 T C 2: 91,212,298 probably null Het
Dlg1 A G 16: 31,788,135 probably null Het
Dnah1 T G 14: 31,286,898 E1973A probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
E130308A19Rik A G 4: 59,691,017 T284A probably benign Het
Ecm1 C T 3: 95,736,103 R295H possibly damaging Het
Efcab5 T A 11: 77,138,229 H92L probably damaging Het
Egfr C A 11: 16,859,029 Y74* probably null Het
Fbxo10 T C 4: 45,040,692 I838V probably benign Het
Gfod2 C T 8: 105,728,011 R79Q probably damaging Het
Gm11568 C A 11: 99,858,448 P160T unknown Het
Gm29106 A T 1: 118,199,220 D214V probably benign Het
Htr3b C A 9: 48,935,941 V425F possibly damaging Het
Lamc2 T C 1: 153,136,805 I708V probably benign Het
Ldb2 T A 5: 44,480,303 K221I probably damaging Het
Lmntd2 A C 7: 141,213,277 S127R probably benign Het
Lrba A G 3: 86,327,436 probably null Het
Mettl26 T A 17: 25,876,776 *202R probably null Het
Mmp24 A G 2: 155,814,096 K485E probably damaging Het
Nap1l1 T C 10: 111,490,083 C88R probably benign Het
Olfr715 C A 7: 107,129,027 R122L probably damaging Het
Olfr913 T A 9: 38,594,362 I47N possibly damaging Het
Pafah1b1 T G 11: 74,685,988 D159A probably damaging Het
Pcdhga7 T C 18: 37,715,645 V235A probably benign Het
Pcf11 T C 7: 92,661,902 T293A probably benign Het
Pidd1 A C 7: 141,438,591 *916E probably null Het
Pip4k2c T C 10: 127,199,375 I375V probably benign Het
Pou3f2 A T 4: 22,487,588 S182T probably benign Het
Rin3 A T 12: 102,368,562 D164V unknown Het
Rnf8 T C 17: 29,626,860 S199P possibly damaging Het
Serpina6 A G 12: 103,653,936 S185P probably benign Het
Slc47a2 C A 11: 61,302,233 V565L probably benign Het
Slfn4 T A 11: 83,187,207 F274I probably damaging Het
Tgif1 T C 17: 70,844,872 Y248C probably benign Het
Tlx1 C A 19: 45,150,982 Q23K possibly damaging Het
Trpv4 T C 5: 114,622,732 D846G probably benign Het
Tspyl1 G A 10: 34,282,338 D20N probably benign Het
Vmn1r159 A T 7: 22,843,534 F24L probably damaging Het
Vmn1r204 T A 13: 22,557,060 V287D probably damaging Het
Zdhhc18 A G 4: 133,612,917 probably null Het
Zfp276 T G 8: 123,267,907 V571G probably damaging Het
Other mutations in Krt86
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Krt86 APN 15 101476515 missense possibly damaging 0.55
IGL00597:Krt86 APN 15 101476226 missense probably benign 0.01
IGL00776:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00800:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00801:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00857:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00902:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00903:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00939:Krt86 APN 15 101473860 missense probably benign 0.00
IGL00954:Krt86 APN 15 101473860 missense probably benign 0.00
IGL01107:Krt86 APN 15 101475425 missense probably damaging 1.00
IGL01638:Krt86 APN 15 101475472 splice site probably benign
IGL02711:Krt86 APN 15 101473662 missense probably damaging 1.00
BB009:Krt86 UTSW 15 101476592 missense probably damaging 1.00
BB019:Krt86 UTSW 15 101476592 missense probably damaging 1.00
R0046:Krt86 UTSW 15 101477402 missense probably benign 0.00
R0193:Krt86 UTSW 15 101479363 splice site probably benign
R0242:Krt86 UTSW 15 101476573 nonsense probably null
R0242:Krt86 UTSW 15 101476573 nonsense probably null
R0607:Krt86 UTSW 15 101479531 missense unknown
R2139:Krt86 UTSW 15 101473758 missense probably benign 0.11
R4464:Krt86 UTSW 15 101473914 missense probably damaging 0.99
R5195:Krt86 UTSW 15 101476933 missense probably benign 0.10
R5587:Krt86 UTSW 15 101473593 missense probably benign 0.01
R5600:Krt86 UTSW 15 101476505 missense probably benign 0.00
R5729:Krt86 UTSW 15 101476548 missense probably benign 0.18
R5876:Krt86 UTSW 15 101476610 missense probably damaging 0.98
R6169:Krt86 UTSW 15 101476289 missense probably damaging 1.00
R6776:Krt86 UTSW 15 101476936 missense probably benign 0.29
R6990:Krt86 UTSW 15 101473833 missense probably benign 0.03
R7111:Krt86 UTSW 15 101476617 missense possibly damaging 0.90
R7932:Krt86 UTSW 15 101476592 missense probably damaging 1.00
R8462:Krt86 UTSW 15 101479403 missense probably benign 0.00
Z1177:Krt86 UTSW 15 101476897 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTCTACTCAGTGCCACACAG -3'
(R):5'- GTGGTGATCTCAACGTCCAG -3'

Sequencing Primer
(F):5'- CCTACCATTTGTACAGCTGGG -3'
(R):5'- GCCCCAGCTTGGAGTTCATC -3'
Posted On2016-05-10