Incidental Mutation 'R4985:Tgif1'
ID385856
Institutional Source Beutler Lab
Gene Symbol Tgif1
Ensembl Gene ENSMUSG00000047407
Gene NameTGFB-induced factor homeobox 1
SynonymsTgif
MMRRC Submission 042579-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4985 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location70844205-70853546 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70844872 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 248 (Y248C)
Ref Sequence ENSEMBL: ENSMUSP00000130930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059775] [ENSMUST00000118283] [ENSMUST00000127719] [ENSMUST00000134654] [ENSMUST00000135007] [ENSMUST00000166395] [ENSMUST00000172229] [ENSMUST00000186358]
Predicted Effect probably benign
Transcript: ENSMUST00000059775
AA Change: Y215C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000060512
Gene: ENSMUSG00000047407
AA Change: Y215C

DomainStartEndE-ValueType
HOX 35 100 1.53e-13 SMART
low complexity region 117 126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118283
AA Change: Y195C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000113192
Gene: ENSMUSG00000047407
AA Change: Y195C

DomainStartEndE-ValueType
HOX 15 80 1.53e-13 SMART
low complexity region 97 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125329
Predicted Effect probably benign
Transcript: ENSMUST00000127719
AA Change: Y195C

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000115375
Gene: ENSMUSG00000047407
AA Change: Y195C

DomainStartEndE-ValueType
HOX 15 80 1.53e-13 SMART
low complexity region 97 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132825
Predicted Effect probably benign
Transcript: ENSMUST00000134654
SMART Domains Protein: ENSMUSP00000125247
Gene: ENSMUSG00000047407

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Pfam:Homeobox_KN 33 58 7.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135007
SMART Domains Protein: ENSMUSP00000124168
Gene: ENSMUSG00000047407

DomainStartEndE-ValueType
HOX 15 80 1.53e-13 SMART
low complexity region 97 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156484
SMART Domains Protein: ENSMUSP00000124970
Gene: ENSMUSG00000047407

DomainStartEndE-ValueType
HOX 6 57 2.23e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166395
AA Change: Y248C

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000130930
Gene: ENSMUSG00000047407
AA Change: Y248C

DomainStartEndE-ValueType
HOX 68 133 1.53e-13 SMART
low complexity region 150 159 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172229
AA Change: Y195C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000127139
Gene: ENSMUSG00000047407
AA Change: Y195C

DomainStartEndE-ValueType
HOX 15 80 1.53e-13 SMART
low complexity region 97 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186358
SMART Domains Protein: ENSMUSP00000139438
Gene: ENSMUSG00000047407

DomainStartEndE-ValueType
HOX 35 84 1.7e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190687
Meta Mutation Damage Score 0.0677 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the three-amino acid loop extension (TALE) superclass of atypical homeodomains. TALE homeobox proteins are highly conserved transcription regulators. This particular homeodomain binds to a previously characterized retinoid X receptor responsive element from the cellular retinol-binding protein II promoter. In addition to its role in inhibiting 9-cis-retinoic acid-dependent RXR alpha transcription activation of the retinoic acid responsive element, the protein is an active transcriptional co-repressor of SMAD2 and may participate in the transmission of nuclear signals during development and in the adult. Mutations in this gene are associated with holoprosencephaly type 4, which is a structural anomaly of the brain. Alternative splicing has been observed at this locus and multiple splice variants encoding distinct isoforms are described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice display normal growth, behavior and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921508M14Rik A T 12: 34,874,458 probably benign Het
Actn4 A G 7: 28,918,986 L83P probably damaging Het
Adgb T C 10: 10,400,632 R331G possibly damaging Het
Arntl T C 7: 113,285,073 V106A probably damaging Het
Brf1 G T 12: 112,969,370 probably null Het
Cd248 C T 19: 5,069,792 T556I probably damaging Het
Cdkn2aip G T 8: 47,713,445 probably benign Het
Ces1d T C 8: 93,175,144 E399G possibly damaging Het
Col9a3 G A 2: 180,603,400 R134H unknown Het
Ddb2 T C 2: 91,212,298 probably null Het
Dlg1 A G 16: 31,788,135 probably null Het
Dnah1 T G 14: 31,286,898 E1973A probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
E130308A19Rik A G 4: 59,691,017 T284A probably benign Het
Ecm1 C T 3: 95,736,103 R295H possibly damaging Het
Efcab5 T A 11: 77,138,229 H92L probably damaging Het
Egfr C A 11: 16,859,029 Y74* probably null Het
Fbxo10 T C 4: 45,040,692 I838V probably benign Het
Gfod2 C T 8: 105,728,011 R79Q probably damaging Het
Gm11568 C A 11: 99,858,448 P160T unknown Het
Gm29106 A T 1: 118,199,220 D214V probably benign Het
Htr3b C A 9: 48,935,941 V425F possibly damaging Het
Krt86 A T 15: 101,477,265 E347V probably damaging Het
Lamc2 T C 1: 153,136,805 I708V probably benign Het
Ldb2 T A 5: 44,480,303 K221I probably damaging Het
Lmntd2 A C 7: 141,213,277 S127R probably benign Het
Lrba A G 3: 86,327,436 probably null Het
Mettl26 T A 17: 25,876,776 *202R probably null Het
Mmp24 A G 2: 155,814,096 K485E probably damaging Het
Nap1l1 T C 10: 111,490,083 C88R probably benign Het
Olfr715 C A 7: 107,129,027 R122L probably damaging Het
Olfr913 T A 9: 38,594,362 I47N possibly damaging Het
Pafah1b1 T G 11: 74,685,988 D159A probably damaging Het
Pcdhga7 T C 18: 37,715,645 V235A probably benign Het
Pcf11 T C 7: 92,661,902 T293A probably benign Het
Pidd1 A C 7: 141,438,591 *916E probably null Het
Pip4k2c T C 10: 127,199,375 I375V probably benign Het
Pou3f2 A T 4: 22,487,588 S182T probably benign Het
Rin3 A T 12: 102,368,562 D164V unknown Het
Rnf8 T C 17: 29,626,860 S199P possibly damaging Het
Serpina6 A G 12: 103,653,936 S185P probably benign Het
Slc47a2 C A 11: 61,302,233 V565L probably benign Het
Slfn4 T A 11: 83,187,207 F274I probably damaging Het
Tlx1 C A 19: 45,150,982 Q23K possibly damaging Het
Trpv4 T C 5: 114,622,732 D846G probably benign Het
Tspyl1 G A 10: 34,282,338 D20N probably benign Het
Vmn1r159 A T 7: 22,843,534 F24L probably damaging Het
Vmn1r204 T A 13: 22,557,060 V287D probably damaging Het
Zdhhc18 A G 4: 133,612,917 probably null Het
Zfp276 T G 8: 123,267,907 V571G probably damaging Het
Other mutations in Tgif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Tgif1 APN 17 70846240 missense probably damaging 1.00
IGL03169:Tgif1 APN 17 70844841 missense possibly damaging 0.93
IGL03179:Tgif1 APN 17 70844947 missense possibly damaging 0.80
R0050:Tgif1 UTSW 17 70850884 missense probably damaging 1.00
R4569:Tgif1 UTSW 17 70844917 missense possibly damaging 0.51
R4877:Tgif1 UTSW 17 70849705 utr 5 prime probably null
R4914:Tgif1 UTSW 17 70845247 missense probably damaging 1.00
R5272:Tgif1 UTSW 17 70846254 missense probably damaging 1.00
R5760:Tgif1 UTSW 17 70845001 missense probably damaging 1.00
R6270:Tgif1 UTSW 17 70844866 unclassified probably null
R6528:Tgif1 UTSW 17 70846560 intron probably benign
R6693:Tgif1 UTSW 17 70850890 start gained probably benign
R7231:Tgif1 UTSW 17 70846173 missense probably damaging 1.00
R7319:Tgif1 UTSW 17 70844852 missense probably damaging 0.99
R7776:Tgif1 UTSW 17 70851457 unclassified probably benign
R7818:Tgif1 UTSW 17 70849608 utr 5 prime probably null
R8100:Tgif1 UTSW 17 70846549 intron probably benign
Predicted Primers PCR Primer
(F):5'- CTGTGAGTTTGGCCTGAAGC -3'
(R):5'- AGAGCCCATTTCATTCCTGCG -3'

Sequencing Primer
(F):5'- GAGTTTGGCCTGAAGCTCCATC -3'
(R):5'- ATTCCTGCGTAGTTGGACC -3'
Posted On2016-05-10