Incidental Mutation 'R4986:Gad1'
ID385863
Institutional Source Beutler Lab
Gene Symbol Gad1
Ensembl Gene ENSMUSG00000070880
Gene Nameglutamate decarboxylase 1
SynonymsGAD25, GAD67, Gad-1, Z49976, GAD44, EP10
MMRRC Submission 042580-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4986 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location70553072-70602014 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70600693 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 560 (D560G)
Ref Sequence ENSEMBL: ENSMUSP00000092539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094934]
Predicted Effect probably benign
Transcript: ENSMUST00000094934
AA Change: D560G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092539
Gene: ENSMUSG00000070880
AA Change: D560G

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Pyridoxal_deC 143 517 7e-154 PFAM
Pfam:Beta_elim_lyase 231 375 3.2e-6 PFAM
Pfam:Aminotran_5 273 380 2.4e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140478
Meta Mutation Damage Score 0.0727 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.2%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: The protein encoded by this gene is an enzyme that catalyzes the production of gamma-aminobutyric acid from L-glutamic acid. Alternative splicing of this gene results in two products, the predominant 67 kDa isoform and a smaller 25 kDa isoform. The smaller isoform is not thought to retain catalytic activity. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for targeted null mutations die at birth with cleft palate and apnea and exhibit reduced levels of glutamic acid decarboxylase and gamma-aminobutyric acid in the cerebral cortex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A T 14: 49,751,654 D619E probably damaging Het
Abcc9 A T 6: 142,627,591 C1005S probably benign Het
Ccdc34 T C 2: 110,017,869 M1T probably null Het
Ceacam5 T A 7: 17,757,833 N709K possibly damaging Het
Ces2f G A 8: 104,952,025 S298N probably benign Het
Defa30 T A 8: 21,135,416 Y65* probably null Het
Dock3 A C 9: 106,931,983 C1314G probably damaging Het
Emc2 A G 15: 43,511,784 M226V probably benign Het
Fat3 T C 9: 15,998,340 Y2122C probably damaging Het
Gm9944 T C 4: 144,453,190 probably benign Het
Gpr137c A T 14: 45,246,286 probably null Het
Igf2bp2 C T 16: 22,070,306 probably null Het
Igsf10 T C 3: 59,328,606 T1385A probably benign Het
Itpr2 T A 6: 146,240,342 N1734I probably damaging Het
Kbtbd6 A G 14: 79,452,609 H248R probably damaging Het
Macf1 C T 4: 123,391,121 R5650Q probably damaging Het
Mdh1 A G 11: 21,558,545 F266L possibly damaging Het
Mecom G T 3: 29,980,699 P466Q probably damaging Het
Muc20 A G 16: 32,777,635 probably benign Het
Olfr1151 T A 2: 87,857,514 L113Q probably damaging Het
Olfr1265 A T 2: 90,037,428 N170Y probably damaging Het
Osmr A G 15: 6,816,580 probably null Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Sacs T A 14: 61,213,043 Y4179* probably null Het
Sept11 T C 5: 93,161,241 V203A probably damaging Het
Skint9 T A 4: 112,391,713 T173S probably benign Het
Slain1 A T 14: 103,688,105 R296S probably damaging Het
Slc36a3 T A 11: 55,146,766 *93C probably null Het
Sp110 G A 1: 85,591,760 P116S probably benign Het
Srl T C 16: 4,496,782 Y332C probably benign Het
Ubtf G A 11: 102,314,174 H95Y probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Ybx1 C T 4: 119,282,430 V123I probably damaging Het
Zfp944 A T 17: 22,339,230 H345Q probably damaging Het
Zfp993 T A 4: 146,657,557 F113I probably benign Het
Other mutations in Gad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01794:Gad1 APN 2 70597168 missense probably benign
IGL01907:Gad1 APN 2 70574126 missense possibly damaging 0.64
IGL02596:Gad1 APN 2 70594684 missense probably damaging 1.00
IGL02654:Gad1 APN 2 70572781 missense possibly damaging 0.88
IGL02998:Gad1 APN 2 70589819 missense probably damaging 1.00
PIT4581001:Gad1 UTSW 2 70599667 missense probably benign 0.05
R0102:Gad1 UTSW 2 70587239 critical splice donor site probably null
R0454:Gad1 UTSW 2 70579201 missense probably damaging 1.00
R0576:Gad1 UTSW 2 70594652 missense probably benign 0.27
R1386:Gad1 UTSW 2 70574123 missense possibly damaging 0.88
R1677:Gad1 UTSW 2 70574177 missense probably damaging 1.00
R1842:Gad1 UTSW 2 70574253 missense probably benign 0.12
R1907:Gad1 UTSW 2 70579138 missense possibly damaging 0.79
R1933:Gad1 UTSW 2 70587392 missense possibly damaging 0.91
R3029:Gad1 UTSW 2 70594690 missense probably benign
R4085:Gad1 UTSW 2 70589848 missense probably benign 0.36
R4321:Gad1 UTSW 2 70589830 missense probably damaging 1.00
R4324:Gad1 UTSW 2 70589830 missense probably damaging 1.00
R4687:Gad1 UTSW 2 70600720 missense possibly damaging 0.94
R5387:Gad1 UTSW 2 70563851 nonsense probably null
R5603:Gad1 UTSW 2 70589829 missense probably damaging 0.98
R6500:Gad1 UTSW 2 70593436 missense probably damaging 0.98
R7146:Gad1 UTSW 2 70587362 missense probably benign 0.00
R7352:Gad1 UTSW 2 70594750 missense probably benign 0.00
R7559:Gad1 UTSW 2 70563912 critical splice donor site probably null
R7579:Gad1 UTSW 2 70587132 missense possibly damaging 0.90
R7809:Gad1 UTSW 2 70597259 missense possibly damaging 0.80
R7941:Gad1 UTSW 2 70594585 splice site probably null
R8290:Gad1 UTSW 2 70574266 missense probably benign 0.00
R8353:Gad1 UTSW 2 70600713 missense probably benign 0.00
R8453:Gad1 UTSW 2 70600713 missense probably benign 0.00
X0026:Gad1 UTSW 2 70589866 missense probably benign 0.00
Z1177:Gad1 UTSW 2 70579130 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTCAACTTGCCCAATGATTTC -3'
(R):5'- AGCTACTGACAGAGCTGTGC -3'

Sequencing Primer
(F):5'- GTAGCCATGAAAAACACTTGGTTC -3'
(R):5'- AGCTGTGCTCTAGGGTACCAG -3'
Posted On2016-05-10