Incidental Mutation 'R4986:Ccdc34'
ID385866
Institutional Source Beutler Lab
Gene Symbol Ccdc34
Ensembl Gene ENSMUSG00000027160
Gene Namecoiled-coil domain containing 34
Synonyms
MMRRC Submission 042580-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R4986 (G1)
Quality Score180
Status Validated
Chromosome2
Chromosomal Location110017817-110173360 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 110017869 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000028580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028580] [ENSMUST00000046548] [ENSMUST00000111037]
Predicted Effect probably null
Transcript: ENSMUST00000028580
AA Change: M1T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000028580
Gene: ENSMUSG00000027160
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
Pfam:DUF4207 62 315 5.6e-56 PFAM
low complexity region 338 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000046548
SMART Domains Protein: ENSMUSP00000047325
Gene: ENSMUSG00000050199

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 28 61 6.68e-6 SMART
LRR 55 79 1.49e1 SMART
LRR 80 103 1.99e0 SMART
LRR_TYP 104 127 2.75e-3 SMART
LRR_TYP 128 151 2.79e-4 SMART
LRR 152 175 2.54e1 SMART
LRR 176 199 4.65e-1 SMART
LRR_TYP 200 223 1.04e-3 SMART
LRR 224 246 6.4e0 SMART
LRR_TYP 247 270 5.99e-4 SMART
LRR 272 294 9.77e1 SMART
LRR 318 341 3e1 SMART
LRR 343 363 4.71e1 SMART
LRR 364 387 1.49e1 SMART
LRR_TYP 388 411 1.15e-5 SMART
LRR 412 435 3.98e1 SMART
low complexity region 500 516 N/A INTRINSIC
Pfam:7tm_1 555 801 2.7e-10 PFAM
low complexity region 824 837 N/A INTRINSIC
low complexity region 910 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111037
SMART Domains Protein: ENSMUSP00000106666
Gene: ENSMUSG00000050199

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 28 61 6.68e-6 SMART
LRR 55 79 9.77e1 SMART
LRR_TYP 80 103 2.75e-3 SMART
LRR_TYP 104 127 2.79e-4 SMART
LRR 128 151 2.54e1 SMART
LRR 152 175 4.65e-1 SMART
LRR_TYP 176 199 1.04e-3 SMART
LRR 200 222 6.4e0 SMART
LRR_TYP 223 246 5.99e-4 SMART
LRR 248 270 9.77e1 SMART
LRR 294 317 3e1 SMART
LRR 319 339 4.71e1 SMART
LRR 340 363 1.49e1 SMART
LRR_TYP 364 387 1.15e-5 SMART
LRR 388 411 3.98e1 SMART
low complexity region 476 492 N/A INTRINSIC
Pfam:7tm_1 531 777 9.3e-17 PFAM
low complexity region 800 813 N/A INTRINSIC
low complexity region 886 900 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126990
Predicted Effect probably benign
Transcript: ENSMUST00000127630
SMART Domains Protein: ENSMUSP00000130554
Gene: ENSMUSG00000027160

DomainStartEndE-ValueType
Pfam:DUF4207 25 174 6.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150183
SMART Domains Protein: ENSMUSP00000127363
Gene: ENSMUSG00000027160

DomainStartEndE-ValueType
Pfam:DUF4207 31 139 3.7e-13 PFAM
Meta Mutation Damage Score 0.9659 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.2%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A T 14: 49,751,654 D619E probably damaging Het
Abcc9 A T 6: 142,627,591 C1005S probably benign Het
Ceacam5 T A 7: 17,757,833 N709K possibly damaging Het
Ces2f G A 8: 104,952,025 S298N probably benign Het
Defa30 T A 8: 21,135,416 Y65* probably null Het
Dock3 A C 9: 106,931,983 C1314G probably damaging Het
Emc2 A G 15: 43,511,784 M226V probably benign Het
Fat3 T C 9: 15,998,340 Y2122C probably damaging Het
Gad1 A G 2: 70,600,693 D560G probably benign Het
Gm9944 T C 4: 144,453,190 probably benign Het
Gpr137c A T 14: 45,246,286 probably null Het
Igf2bp2 C T 16: 22,070,306 probably null Het
Igsf10 T C 3: 59,328,606 T1385A probably benign Het
Itpr2 T A 6: 146,240,342 N1734I probably damaging Het
Kbtbd6 A G 14: 79,452,609 H248R probably damaging Het
Macf1 C T 4: 123,391,121 R5650Q probably damaging Het
Mdh1 A G 11: 21,558,545 F266L possibly damaging Het
Mecom G T 3: 29,980,699 P466Q probably damaging Het
Muc20 A G 16: 32,777,635 probably benign Het
Olfr1151 T A 2: 87,857,514 L113Q probably damaging Het
Olfr1265 A T 2: 90,037,428 N170Y probably damaging Het
Osmr A G 15: 6,816,580 probably null Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Sacs T A 14: 61,213,043 Y4179* probably null Het
Sept11 T C 5: 93,161,241 V203A probably damaging Het
Skint9 T A 4: 112,391,713 T173S probably benign Het
Slain1 A T 14: 103,688,105 R296S probably damaging Het
Slc36a3 T A 11: 55,146,766 *93C probably null Het
Sp110 G A 1: 85,591,760 P116S probably benign Het
Srl T C 16: 4,496,782 Y332C probably benign Het
Ubtf G A 11: 102,314,174 H95Y probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Ybx1 C T 4: 119,282,430 V123I probably damaging Het
Zfp944 A T 17: 22,339,230 H345Q probably damaging Het
Zfp993 T A 4: 146,657,557 F113I probably benign Het
Other mutations in Ccdc34
AlleleSourceChrCoordTypePredicted EffectPPH Score
marrowfuel UTSW 2 110044227 nonsense probably null
peek UTSW 2 110018007 missense probably benign 0.04
LCD18:Ccdc34 UTSW 2 110016318 unclassified probably benign
R1808:Ccdc34 UTSW 2 110044256 missense probably benign 0.15
R2011:Ccdc34 UTSW 2 110044304 missense possibly damaging 0.93
R2025:Ccdc34 UTSW 2 110032386 missense possibly damaging 0.95
R3852:Ccdc34 UTSW 2 110032428 missense possibly damaging 0.95
R4968:Ccdc34 UTSW 2 110040733 critical splice donor site probably null
R6075:Ccdc34 UTSW 2 110044235 missense possibly damaging 0.77
R6103:Ccdc34 UTSW 2 110018007 missense probably benign 0.04
R6294:Ccdc34 UTSW 2 110018151 missense probably benign 0.08
R7856:Ccdc34 UTSW 2 110044227 nonsense probably null
X0025:Ccdc34 UTSW 2 110044312 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACCTGGACTGAGGAAGCCAAG -3'
(R):5'- CAAACGGAAAGCTCTGGTGG -3'

Sequencing Primer
(F):5'- TGAGGAAGCCAAGCTCTTC -3'
(R):5'- AGTTGCTGCAGCTCAGAGAC -3'
Posted On2016-05-10