Incidental Mutation 'R4986:Ybx1'
ID385870
Institutional Source Beutler Lab
Gene Symbol Ybx1
Ensembl Gene ENSMUSG00000028639
Gene NameY box protein 1
SynonymsdbpB, DNA binding protein B, EF1A, MSY1, Nsep1, YB-1
MMRRC Submission 042580-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4986 (G1)
Quality Score224
Status Validated
Chromosome4
Chromosomal Location119277981-119294604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119282430 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 123 (V123I)
Ref Sequence ENSEMBL: ENSMUSP00000078589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079644] [ENSMUST00000127737]
Predicted Effect probably damaging
Transcript: ENSMUST00000079644
AA Change: V123I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078589
Gene: ENSMUSG00000028639
AA Change: V123I

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 25 48 N/A INTRINSIC
CSP 58 126 8.65e-24 SMART
low complexity region 140 159 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
low complexity region 179 206 N/A INTRINSIC
low complexity region 236 254 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000127737
AA Change: V11I

PolyPhen 2 Score 0.720 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117225
Gene: ENSMUSG00000028639
AA Change: V11I

DomainStartEndE-ValueType
low complexity region 28 47 N/A INTRINSIC
low complexity region 50 62 N/A INTRINSIC
low complexity region 67 94 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145976
Meta Mutation Damage Score 0.5463 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.2%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved cold shock domain protein that has broad nucleic acid binding properties. The encoded protein functions as both a DNA and RNA binding protein and has been implicated in numerous cellular processes including regulation of transcription and translation, pre-mRNA splicing, DNA reparation and mRNA packaging. This protein is also a component of messenger ribonucleoprotein (mRNP) complexes and may have a role in microRNA processing. This protein can be secreted through non-classical pathways and functions as an extracellular mitogen. Aberrant expression of the gene is associated with cancer proliferation in numerous tissues. This gene may be a prognostic marker for poor outcome and drug resistance in certain cancers. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on multiple chromosomes. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice exhibit embryonic and perinatal lethality and are severely growth retarded. Some mice exhibit craniofacial defects and respiratory failure. MEFs are more sensitive to oxidative stress resulting in premature senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A T 14: 49,751,654 D619E probably damaging Het
Abcc9 A T 6: 142,627,591 C1005S probably benign Het
Ccdc34 T C 2: 110,017,869 M1T probably null Het
Ceacam5 T A 7: 17,757,833 N709K possibly damaging Het
Ces2f G A 8: 104,952,025 S298N probably benign Het
Defa30 T A 8: 21,135,416 Y65* probably null Het
Dock3 A C 9: 106,931,983 C1314G probably damaging Het
Emc2 A G 15: 43,511,784 M226V probably benign Het
Fat3 T C 9: 15,998,340 Y2122C probably damaging Het
Gad1 A G 2: 70,600,693 D560G probably benign Het
Gm9944 T C 4: 144,453,190 probably benign Het
Gpr137c A T 14: 45,246,286 probably null Het
Igf2bp2 C T 16: 22,070,306 probably null Het
Igsf10 T C 3: 59,328,606 T1385A probably benign Het
Itpr2 T A 6: 146,240,342 N1734I probably damaging Het
Kbtbd6 A G 14: 79,452,609 H248R probably damaging Het
Macf1 C T 4: 123,391,121 R5650Q probably damaging Het
Mdh1 A G 11: 21,558,545 F266L possibly damaging Het
Mecom G T 3: 29,980,699 P466Q probably damaging Het
Muc20 A G 16: 32,777,635 probably benign Het
Olfr1151 T A 2: 87,857,514 L113Q probably damaging Het
Olfr1265 A T 2: 90,037,428 N170Y probably damaging Het
Osmr A G 15: 6,816,580 probably null Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Sacs T A 14: 61,213,043 Y4179* probably null Het
Sept11 T C 5: 93,161,241 V203A probably damaging Het
Skint9 T A 4: 112,391,713 T173S probably benign Het
Slain1 A T 14: 103,688,105 R296S probably damaging Het
Slc36a3 T A 11: 55,146,766 *93C probably null Het
Sp110 G A 1: 85,591,760 P116S probably benign Het
Srl T C 16: 4,496,782 Y332C probably benign Het
Ubtf G A 11: 102,314,174 H95Y probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Zfp944 A T 17: 22,339,230 H345Q probably damaging Het
Zfp993 T A 4: 146,657,557 F113I probably benign Het
Other mutations in Ybx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02000:Ybx1 APN 4 119282312 missense probably damaging 1.00
IGL02635:Ybx1 APN 4 119279089 missense possibly damaging 0.88
BB001:Ybx1 UTSW 4 119282279 missense probably damaging 0.97
BB011:Ybx1 UTSW 4 119282279 missense probably damaging 0.97
R0136:Ybx1 UTSW 4 119282354 missense possibly damaging 0.57
R0270:Ybx1 UTSW 4 119281591 missense probably benign 0.11
R4911:Ybx1 UTSW 4 119282813 missense probably benign 0.13
R4957:Ybx1 UTSW 4 119278938 utr 3 prime probably benign
R5205:Ybx1 UTSW 4 119279151 missense probably damaging 1.00
R7098:Ybx1 UTSW 4 119282853 missense possibly damaging 0.65
R7706:Ybx1 UTSW 4 119278967 makesense probably null
R7924:Ybx1 UTSW 4 119282279 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGAATACTGTGGTCGACGC -3'
(R):5'- GCTAATGATGTAGCATTCCCATG -3'

Sequencing Primer
(F):5'- CATAGGGTCTCCGCATGTAGTAAG -3'
(R):5'- GCACCCTTTGCCCATGC -3'
Posted On2016-05-10