Incidental Mutation 'R4986:Sept11'
ID385874
Institutional Source Beutler Lab
Gene Symbol Sept11
Ensembl Gene ENSMUSG00000058013
Gene Nameseptin 11
Synonyms6230410I01Rik, D5Ertd606e
MMRRC Submission 042580-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.467) question?
Stock #R4986 (G1)
Quality Score156
Status Validated
Chromosome5
Chromosomal Location93093437-93176447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93161241 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 203 (V203A)
Ref Sequence ENSEMBL: ENSMUSP00000144573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074733] [ENSMUST00000201421] [ENSMUST00000201700] [ENSMUST00000202196] [ENSMUST00000202217] [ENSMUST00000202308]
Predicted Effect probably damaging
Transcript: ENSMUST00000074733
AA Change: V260A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074293
Gene: ENSMUSG00000058013
AA Change: V260A

DomainStartEndE-ValueType
Pfam:Septin 38 311 5.3e-101 PFAM
Pfam:MMR_HSR1 43 185 3.8e-8 PFAM
low complexity region 350 366 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201421
AA Change: V260A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143928
Gene: ENSMUSG00000058013
AA Change: V260A

DomainStartEndE-ValueType
Pfam:Septin 38 311 5.3e-101 PFAM
Pfam:MMR_HSR1 43 185 3.8e-8 PFAM
low complexity region 350 366 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201695
Predicted Effect probably damaging
Transcript: ENSMUST00000201700
AA Change: V260A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143901
Gene: ENSMUSG00000058013
AA Change: V260A

DomainStartEndE-ValueType
Pfam:Septin 38 311 7.9e-99 PFAM
Pfam:MMR_HSR1 43 185 7e-7 PFAM
coiled coil region 333 409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202196
AA Change: V203A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144573
Gene: ENSMUSG00000058013
AA Change: V203A

DomainStartEndE-ValueType
Pfam:Septin 1 204 5.9e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202217
AA Change: V260A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144235
Gene: ENSMUSG00000058013
AA Change: V260A

DomainStartEndE-ValueType
Pfam:Septin 38 311 7.7e-101 PFAM
Pfam:MMR_HSR1 43 185 4.1e-8 PFAM
low complexity region 350 366 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202308
AA Change: V260A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144136
Gene: ENSMUSG00000058013
AA Change: V260A

DomainStartEndE-ValueType
Pfam:Septin 38 311 5.1e-101 PFAM
Pfam:MMR_HSR1 43 185 3.7e-8 PFAM
low complexity region 350 366 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
Meta Mutation Damage Score 0.3530 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.2%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SEPT11 belongs to the conserved septin family of filament-forming cytoskeletal GTPases that are involved in a variety of cellular functions including cytokinesis and vesicle trafficking (Hanai et al., 2004 [PubMed 15196925]; Nagata et al., 2004 [PubMed 15485874]).[supplied by OMIM, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A T 14: 49,751,654 D619E probably damaging Het
Abcc9 A T 6: 142,627,591 C1005S probably benign Het
Ccdc34 T C 2: 110,017,869 M1T probably null Het
Ceacam5 T A 7: 17,757,833 N709K possibly damaging Het
Ces2f G A 8: 104,952,025 S298N probably benign Het
Defa30 T A 8: 21,135,416 Y65* probably null Het
Dock3 A C 9: 106,931,983 C1314G probably damaging Het
Emc2 A G 15: 43,511,784 M226V probably benign Het
Fat3 T C 9: 15,998,340 Y2122C probably damaging Het
Gad1 A G 2: 70,600,693 D560G probably benign Het
Gm9944 T C 4: 144,453,190 probably benign Het
Gpr137c A T 14: 45,246,286 probably null Het
Igf2bp2 C T 16: 22,070,306 probably null Het
Igsf10 T C 3: 59,328,606 T1385A probably benign Het
Itpr2 T A 6: 146,240,342 N1734I probably damaging Het
Kbtbd6 A G 14: 79,452,609 H248R probably damaging Het
Macf1 C T 4: 123,391,121 R5650Q probably damaging Het
Mdh1 A G 11: 21,558,545 F266L possibly damaging Het
Mecom G T 3: 29,980,699 P466Q probably damaging Het
Muc20 A G 16: 32,777,635 probably benign Het
Olfr1151 T A 2: 87,857,514 L113Q probably damaging Het
Olfr1265 A T 2: 90,037,428 N170Y probably damaging Het
Osmr A G 15: 6,816,580 probably null Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Sacs T A 14: 61,213,043 Y4179* probably null Het
Skint9 T A 4: 112,391,713 T173S probably benign Het
Slain1 A T 14: 103,688,105 R296S probably damaging Het
Slc36a3 T A 11: 55,146,766 *93C probably null Het
Sp110 G A 1: 85,591,760 P116S probably benign Het
Srl T C 16: 4,496,782 Y332C probably benign Het
Ubtf G A 11: 102,314,174 H95Y probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Ybx1 C T 4: 119,282,430 V123I probably damaging Het
Zfp944 A T 17: 22,339,230 H345Q probably damaging Het
Zfp993 T A 4: 146,657,557 F113I probably benign Het
Other mutations in Sept11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Sept11 APN 5 93157018 splice site probably null
IGL00984:Sept11 APN 5 93162184 missense possibly damaging 0.90
IGL01452:Sept11 APN 5 93161204 missense possibly damaging 0.82
IGL01677:Sept11 APN 5 93148533 missense probably damaging 0.98
IGL01732:Sept11 APN 5 93161226 missense probably damaging 1.00
IGL02476:Sept11 APN 5 93148584 critical splice donor site probably null
I0000:Sept11 UTSW 5 93165259 missense probably benign 0.05
R0544:Sept11 UTSW 5 93165368 missense possibly damaging 0.80
R0611:Sept11 UTSW 5 93167534 missense probably damaging 0.99
R1438:Sept11 UTSW 5 93148428 missense probably damaging 1.00
R1702:Sept11 UTSW 5 93156924 missense probably damaging 1.00
R1727:Sept11 UTSW 5 93156924 missense probably damaging 1.00
R3838:Sept11 UTSW 5 93148399 missense probably damaging 1.00
R3847:Sept11 UTSW 5 93162167 missense probably damaging 1.00
R4609:Sept11 UTSW 5 93162254 missense possibly damaging 0.89
R4717:Sept11 UTSW 5 93156956 missense possibly damaging 0.89
R4852:Sept11 UTSW 5 93162253 missense possibly damaging 0.52
R5806:Sept11 UTSW 5 93167578 missense probably benign 0.18
R5826:Sept11 UTSW 5 93139450 missense possibly damaging 0.79
R5896:Sept11 UTSW 5 93156965 missense probably damaging 1.00
R6641:Sept11 UTSW 5 93139552 missense probably damaging 1.00
R7144:Sept11 UTSW 5 93156866 missense probably benign 0.00
R7479:Sept11 UTSW 5 93156945 missense probably damaging 0.99
R7757:Sept11 UTSW 5 93171464 splice site probably null
R8056:Sept11 UTSW 5 93167576 missense unknown
R8103:Sept11 UTSW 5 93161148 critical splice acceptor site probably null
Z1177:Sept11 UTSW 5 93156963 missense probably damaging 0.96
Z1177:Sept11 UTSW 5 93162283 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAAGACCCCTCTCTGATGGG -3'
(R):5'- GTCTACCTGCCCTACTGATGAC -3'

Sequencing Primer
(F):5'- GGACAGGAGCTCTGATTGG -3'
(R):5'- CATTTCTTCATCACGGGC -3'
Posted On2016-05-10