Mutagenetix > Incidental Mutations

Incidental Mutation 'R4986:Ceacam5'

385877

Institutional Source

Beutler Lab

Gene Symbol

Ceacam5

Ensembl Gene

ENSMUSG00000008789

Gene Name

carcinoembryonic antigen-related cell adhesion molecule 5

Synonyms

Psg30, 1600029H12Rik

MMRRC Submission

042580-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.056) question?

Stock #

R4986 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

17713238-17761132 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 17757833 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 709 (N709K)

Ref Sequence

ENSEMBL: ENSMUSP00000080582 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081907]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081907
AA Change: N709K

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000080582
Gene: ENSMUSG00000008789
AA Change: N709K

Domain	Start	End	E-Value	Type
IG	40	141	4.46e-1	SMART
IG_like	160	261	2.96e1	SMART
IG_like	277	378	5.86e0	SMART
IG_like	397	496	4.07e1	SMART
IG	514	615	2.64e0	SMART
IG_like	634	735	2.81e1	SMART
IG	753	853	1.72e-2	SMART
IGc2	869	933	1.28e-10	SMART

Meta Mutation Damage Score

0.1257

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.2%

Validation Efficiency

95% (41/43)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	A	T	14: 49,751,654	D619E	probably damaging	Het
Abcc9	A	T	6: 142,627,591	C1005S	probably benign	Het
Ccdc34	T	C	2: 110,017,869	M1T	probably null	Het
Ces2f	G	A	8: 104,952,025	S298N	probably benign	Het
Defa30	T	A	8: 21,135,416	Y65*	probably null	Het
Dock3	A	C	9: 106,931,983	C1314G	probably damaging	Het
Emc2	A	G	15: 43,511,784	M226V	probably benign	Het
Fat3	T	C	9: 15,998,340	Y2122C	probably damaging	Het
Gad1	A	G	2: 70,600,693	D560G	probably benign	Het
Gm9944	T	C	4: 144,453,190		probably benign	Het
Gpr137c	A	T	14: 45,246,286		probably null	Het
Igf2bp2	C	T	16: 22,070,306		probably null	Het
Igsf10	T	C	3: 59,328,606	T1385A	probably benign	Het
Itpr2	T	A	6: 146,240,342	N1734I	probably damaging	Het
Kbtbd6	A	G	14: 79,452,609	H248R	probably damaging	Het
Macf1	C	T	4: 123,391,121	R5650Q	probably damaging	Het
Mdh1	A	G	11: 21,558,545	F266L	possibly damaging	Het
Mecom	G	T	3: 29,980,699	P466Q	probably damaging	Het
Muc20	A	G	16: 32,777,635		probably benign	Het
Olfr1151	T	A	2: 87,857,514	L113Q	probably damaging	Het
Olfr1265	A	T	2: 90,037,428	N170Y	probably damaging	Het
Osmr	A	G	15: 6,816,580		probably null	Het
Rrs1	G	A	1: 9,545,767	E82K	probably damaging	Het
Sacs	T	A	14: 61,213,043	Y4179*	probably null	Het
Sept11	T	C	5: 93,161,241	V203A	probably damaging	Het
Skint9	T	A	4: 112,391,713	T173S	probably benign	Het
Slain1	A	T	14: 103,688,105	R296S	probably damaging	Het
Slc36a3	T	A	11: 55,146,766	*93C	probably null	Het
Sp110	G	A	1: 85,591,760	P116S	probably benign	Het
Srl	T	C	16: 4,496,782	Y332C	probably benign	Het
Ubtf	G	A	11: 102,314,174	H95Y	probably benign	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Wdfy3	C	T	5: 101,943,119	D532N	probably benign	Het
Ybx1	C	T	4: 119,282,430	V123I	probably damaging	Het
Zfp944	A	T	17: 22,339,230	H345Q	probably damaging	Het
Zfp993	T	A	4: 146,657,557	F113I	probably benign	Het

Other mutations in Ceacam5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Ceacam5	APN	7	17759556	nonsense	probably null
IGL00981:Ceacam5	APN	7	17745533	missense	probably benign	0.08
IGL01314:Ceacam5	APN	7	17747256	nonsense	probably null
IGL01329:Ceacam5	APN	7	17745609	missense	probably damaging	0.98
IGL01389:Ceacam5	APN	7	17747375	missense	probably damaging	0.96
IGL01418:Ceacam5	APN	7	17745599	missense	probably damaging	1.00
IGL02418:Ceacam5	APN	7	17759434	missense	possibly damaging	0.71
IGL02734:Ceacam5	APN	7	17750812	missense	probably damaging	1.00
IGL03220:Ceacam5	APN	7	17760728	missense	probably damaging	1.00
IGL03377:Ceacam5	APN	7	17715131	missense	probably benign	0.15
IGL03395:Ceacam5	APN	7	17745379	splice site	probably benign
IGL03054:Ceacam5	UTSW	7	17759454	missense	possibly damaging	0.71
R0456:Ceacam5	UTSW	7	17760851	missense	possibly damaging	0.63
R0624:Ceacam5	UTSW	7	17714963	missense	probably benign	0.03
R0847:Ceacam5	UTSW	7	17757837	missense	possibly damaging	0.71
R0879:Ceacam5	UTSW	7	17757702	missense	probably benign	0.16
R0945:Ceacam5	UTSW	7	17747344	missense	probably damaging	1.00
R1382:Ceacam5	UTSW	7	17752165	missense	probably benign	0.33
R1474:Ceacam5	UTSW	7	17747234	missense	probably damaging	1.00
R1526:Ceacam5	UTSW	7	17750695	missense	probably damaging	1.00
R1793:Ceacam5	UTSW	7	17747395	missense	probably benign	0.01
R1851:Ceacam5	UTSW	7	17714910	nonsense	probably null
R1907:Ceacam5	UTSW	7	17752384	missense	possibly damaging	0.85
R1913:Ceacam5	UTSW	7	17759577	nonsense	probably null
R1990:Ceacam5	UTSW	7	17757880	missense	probably damaging	0.99
R1999:Ceacam5	UTSW	7	17747247	missense	possibly damaging	0.66
R2336:Ceacam5	UTSW	7	17747375	missense	probably benign	0.28
R2355:Ceacam5	UTSW	7	17745635	missense	probably damaging	1.00
R3106:Ceacam5	UTSW	7	17747323	missense	probably benign	0.06
R3423:Ceacam5	UTSW	7	17757637	missense	possibly damaging	0.52
R3432:Ceacam5	UTSW	7	17714976	missense	probably benign	0.06
R3686:Ceacam5	UTSW	7	17760823	missense	possibly damaging	0.94
R3713:Ceacam5	UTSW	7	17759338	missense	possibly damaging	0.52
R3878:Ceacam5	UTSW	7	17750581	missense	probably damaging	1.00
R4214:Ceacam5	UTSW	7	17752151	missense	probably benign	0.00
R4335:Ceacam5	UTSW	7	17752129	missense	probably benign
R4725:Ceacam5	UTSW	7	17760677	missense	probably benign	0.26
R4823:Ceacam5	UTSW	7	17757744	missense	possibly damaging	0.71
R4833:Ceacam5	UTSW	7	17752258	missense	probably benign
R5099:Ceacam5	UTSW	7	17745588	missense	probably damaging	0.96
R5365:Ceacam5	UTSW	7	17759548	missense	probably damaging	0.98
R5522:Ceacam5	UTSW	7	17715080	missense	probably benign
R5605:Ceacam5	UTSW	7	17747236	missense	probably benign	0.03
R6199:Ceacam5	UTSW	7	17714885	missense	probably benign	0.00
R6222:Ceacam5	UTSW	7	17745547	missense	probably benign	0.15
R6320:Ceacam5	UTSW	7	17747198	missense	probably damaging	1.00
R6464:Ceacam5	UTSW	7	17747466	critical splice donor site	probably null
R6521:Ceacam5	UTSW	7	17750831	critical splice donor site	probably null
R6568:Ceacam5	UTSW	7	17745491	missense	probably damaging	1.00
R6573:Ceacam5	UTSW	7	17713447	start codon destroyed	probably null	0.70
R6814:Ceacam5	UTSW	7	17752287	nonsense	probably null
R6872:Ceacam5	UTSW	7	17752287	nonsense	probably null
R6930:Ceacam5	UTSW	7	17750834	splice site	probably null
R7071:Ceacam5	UTSW	7	17750652	missense	possibly damaging	0.49
R7121:Ceacam5	UTSW	7	17745537	missense	probably benign	0.29
R7174:Ceacam5	UTSW	7	17757914	critical splice donor site	probably null
R7187:Ceacam5	UTSW	7	17759485	missense	possibly damaging	0.85
R7355:Ceacam5	UTSW	7	17747387	missense	probably damaging	1.00
R7411:Ceacam5	UTSW	7	17750753	missense	probably damaging	0.99
R7462:Ceacam5	UTSW	7	17760839	missense	probably damaging	1.00
R7612:Ceacam5	UTSW	7	17759416	missense	possibly damaging	0.86
R7803:Ceacam5	UTSW	7	17759392	missense	probably damaging	0.98
R7943:Ceacam5	UTSW	7	17745566	missense	probably benign	0.26
R8342:Ceacam5	UTSW	7	17752246	missense	possibly damaging	0.53
R8356:Ceacam5	UTSW	7	17745699	missense	possibly damaging	0.68
R8426:Ceacam5	UTSW	7	17759341	missense	possibly damaging	0.51
R8456:Ceacam5	UTSW	7	17745699	missense	possibly damaging	0.68
R8534:Ceacam5	UTSW	7	17750746	missense	probably benign	0.20
X0020:Ceacam5	UTSW	7	17760909	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTCAGTATAGAATCAGTGCCCC -3'
(R):5'- TTGAGACACAATGCAGTGGG -3'

Sequencing Primer
(F):5'- GAAAGTGTTCTTCTACTGGTTCAC -3'
(R):5'- GGAAGGAGACACAATACAGTCATGAC -3'

Posted On

2016-05-10