Mutagenetix > Incidental Mutations

Incidental Mutation 'R4986:Sacs'

385888

Institutional Source

Beutler Lab

Gene Symbol

Sacs

Ensembl Gene

ENSMUSG00000048279

Gene Name

sacsin

Synonyms

E130115J16Rik

MMRRC Submission

042580-MU

Accession Numbers

Genbank: NM_172809; MGI: 1354724; Ensembl: ENSMUST00000119943

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4986 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

61138457-61240695 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 61213043 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 4179 (Y4179*)

Ref Sequence

ENSEMBL: ENSMUSP00000113377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119943]

Predicted Effect

probably benign
Transcript: ENSMUST00000089394

SMART Domains

Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279

Domain	Start	End	E-Value	Type
SCOP:d1lm8b_	8	66	3e-3	SMART
Blast:UBQ	9	81	3e-31	BLAST
Blast:HATPase_c	116	211	2e-10	BLAST
low complexity region	608	623	N/A	INTRINSIC
low complexity region	664	673	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000119943
AA Change: Y4179*

SMART Domains

Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: Y4179*

Domain	Start	End	E-Value	Type
internal_repeat_1	61	514	1.35e-52	PROSPERO
low complexity region	608	623	N/A	INTRINSIC
low complexity region	664	673	N/A	INTRINSIC
low complexity region	1019	1033	N/A	INTRINSIC
low complexity region	1131	1145	N/A	INTRINSIC
low complexity region	1526	1537	N/A	INTRINSIC
low complexity region	2454	2463	N/A	INTRINSIC
internal_repeat_1	2475	2934	1.35e-52	PROSPERO
low complexity region	3751	3760	N/A	INTRINSIC
low complexity region	3997	4012	N/A	INTRINSIC
low complexity region	4285	4300	N/A	INTRINSIC
Blast:DnaJ	4304	4363	1e-31	BLAST
PDB:1IUR\|A	4309	4376	5e-39	PDB
SCOP:d1gh6a_	4317	4407	2e-3	SMART
HEPN	4454	4570	9.49e-24	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.2%

Validation Efficiency

95% (41/43)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	A	T	14: 49,751,654	D619E	probably damaging	Het
Abcc9	A	T	6: 142,627,591	C1005S	probably benign	Het
Ccdc34	T	C	2: 110,017,869	M1T	probably null	Het
Ceacam5	T	A	7: 17,757,833	N709K	possibly damaging	Het
Ces2f	G	A	8: 104,952,025	S298N	probably benign	Het
Defa30	T	A	8: 21,135,416	Y65*	probably null	Het
Dock3	A	C	9: 106,931,983	C1314G	probably damaging	Het
Emc2	A	G	15: 43,511,784	M226V	probably benign	Het
Fat3	T	C	9: 15,998,340	Y2122C	probably damaging	Het
Gad1	A	G	2: 70,600,693	D560G	probably benign	Het
Gm9944	T	C	4: 144,453,190		probably benign	Het
Gpr137c	A	T	14: 45,246,286		probably null	Het
Igf2bp2	C	T	16: 22,070,306		probably null	Het
Igsf10	T	C	3: 59,328,606	T1385A	probably benign	Het
Itpr2	T	A	6: 146,240,342	N1734I	probably damaging	Het
Kbtbd6	A	G	14: 79,452,609	H248R	probably damaging	Het
Macf1	C	T	4: 123,391,121	R5650Q	probably damaging	Het
Mdh1	A	G	11: 21,558,545	F266L	possibly damaging	Het
Mecom	G	T	3: 29,980,699	P466Q	probably damaging	Het
Muc20	A	G	16: 32,777,635		probably benign	Het
Olfr1151	T	A	2: 87,857,514	L113Q	probably damaging	Het
Olfr1265	A	T	2: 90,037,428	N170Y	probably damaging	Het
Osmr	A	G	15: 6,816,580		probably null	Het
Rrs1	G	A	1: 9,545,767	E82K	probably damaging	Het
Sept11	T	C	5: 93,161,241	V203A	probably damaging	Het
Skint9	T	A	4: 112,391,713	T173S	probably benign	Het
Slain1	A	T	14: 103,688,105	R296S	probably damaging	Het
Slc36a3	T	A	11: 55,146,766	*93C	probably null	Het
Sp110	G	A	1: 85,591,760	P116S	probably benign	Het
Srl	T	C	16: 4,496,782	Y332C	probably benign	Het
Ubtf	G	A	11: 102,314,174	H95Y	probably benign	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Wdfy3	C	T	5: 101,943,119	D532N	probably benign	Het
Ybx1	C	T	4: 119,282,430	V123I	probably damaging	Het
Zfp944	A	T	17: 22,339,230	H345Q	probably damaging	Het
Zfp993	T	A	4: 146,657,557	F113I	probably benign	Het

Other mutations in Sacs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Sacs	APN	14	61191635	missense	possibly damaging	0.64
IGL01839:Sacs	APN	14	61183945	intron	probably benign
IGL02024:Sacs	APN	14	61189678	missense	probably damaging	0.96
IGL02247:Sacs	APN	14	61192535	missense	probably damaging	1.00
BB009:Sacs	UTSW	14	61204878	missense	probably damaging	0.99
BB019:Sacs	UTSW	14	61204878	missense	probably damaging	0.99
F6893:Sacs	UTSW	14	61212976	missense	probably benign
IGL03052:Sacs	UTSW	14	61207858	missense	probably damaging	0.99
R0090:Sacs	UTSW	14	61205440	missense	probably damaging	1.00
R0102:Sacs	UTSW	14	61204568	missense	probably damaging	1.00
R0102:Sacs	UTSW	14	61204568	missense	probably damaging	1.00
R0390:Sacs	UTSW	14	61205640	missense	possibly damaging	0.92
R0479:Sacs	UTSW	14	61191479	missense	probably damaging	0.99
R0556:Sacs	UTSW	14	61183958	missense	probably damaging	0.99
R0673:Sacs	UTSW	14	61210215	missense	possibly damaging	0.89
R0748:Sacs	UTSW	14	61209265	missense	probably damaging	0.99
R0931:Sacs	UTSW	14	61203495	missense	probably benign
R0972:Sacs	UTSW	14	61211963	nonsense	probably null
R1281:Sacs	UTSW	14	61191801	missense	probably benign	0.02
R1340:Sacs	UTSW	14	61204509	missense	probably damaging	0.98
R1351:Sacs	UTSW	14	61202761	missense	probably benign	0.00
R1499:Sacs	UTSW	14	61213704	missense	possibly damaging	0.70
R1538:Sacs	UTSW	14	61210059	missense	probably damaging	0.98
R1581:Sacs	UTSW	14	61213679	missense	probably damaging	0.96
R1599:Sacs	UTSW	14	61203638	missense	probably benign
R1631:Sacs	UTSW	14	61210732	nonsense	probably null
R1635:Sacs	UTSW	14	61203828	missense	probably damaging	0.98
R1655:Sacs	UTSW	14	61191782	missense	probably benign
R1660:Sacs	UTSW	14	61209009	missense	probably damaging	0.99
R1707:Sacs	UTSW	14	61209762	missense	probably benign	0.01
R1733:Sacs	UTSW	14	61205454	missense	probably damaging	1.00
R1772:Sacs	UTSW	14	61210897	missense	probably damaging	1.00
R1976:Sacs	UTSW	14	61202895	missense	probably benign
R2055:Sacs	UTSW	14	61214049	missense	probably damaging	0.97
R2083:Sacs	UTSW	14	61206506	missense	possibly damaging	0.69
R2091:Sacs	UTSW	14	61191919	missense	possibly damaging	0.95
R2105:Sacs	UTSW	14	61173441	missense	possibly damaging	0.90
R2109:Sacs	UTSW	14	61173453	splice site	probably null
R2117:Sacs	UTSW	14	61213771	missense	probably benign	0.01
R2122:Sacs	UTSW	14	61212316	missense	probably damaging	1.00
R2148:Sacs	UTSW	14	61173378	missense	probably damaging	0.97
R2151:Sacs	UTSW	14	61209640	missense	probably damaging	1.00
R2231:Sacs	UTSW	14	61205929	splice site	probably null
R2248:Sacs	UTSW	14	61212802	missense	probably damaging	1.00
R2271:Sacs	UTSW	14	61204660	missense	probably benign	0.06
R2314:Sacs	UTSW	14	61207759	missense	probably benign	0.17
R2436:Sacs	UTSW	14	61202905	missense	possibly damaging	0.94
R2445:Sacs	UTSW	14	61205206	missense	probably damaging	1.00
R2512:Sacs	UTSW	14	61203080	missense	probably benign	0.00
R3434:Sacs	UTSW	14	61212303	missense	probably damaging	1.00
R3785:Sacs	UTSW	14	61183961	missense	probably damaging	1.00
R3786:Sacs	UTSW	14	61183961	missense	probably damaging	1.00
R3796:Sacs	UTSW	14	61206121	missense	possibly damaging	0.87
R3798:Sacs	UTSW	14	61206121	missense	possibly damaging	0.87
R3872:Sacs	UTSW	14	61148068	missense	probably benign	0.30
R3873:Sacs	UTSW	14	61192286	missense	possibly damaging	0.64
R3892:Sacs	UTSW	14	61204387	missense	probably damaging	0.98
R4184:Sacs	UTSW	14	61213944	missense	probably damaging	0.97
R4204:Sacs	UTSW	14	61173443	missense	possibly damaging	0.93
R4249:Sacs	UTSW	14	61203457	missense	probably benign	0.02
R4256:Sacs	UTSW	14	61206337	missense	probably damaging	1.00
R4370:Sacs	UTSW	14	61212309	missense	probably damaging	1.00
R4445:Sacs	UTSW	14	61204686	missense	probably benign	0.30
R4503:Sacs	UTSW	14	61207603	missense	probably damaging	1.00
R4548:Sacs	UTSW	14	61191938	missense	probably damaging	1.00
R4582:Sacs	UTSW	14	61191698	missense	probably damaging	1.00
R4613:Sacs	UTSW	14	61211797	splice site	probably null
R4639:Sacs	UTSW	14	61207268	missense	probably benign	0.12
R4697:Sacs	UTSW	14	61212747	missense	probably benign	0.19
R4706:Sacs	UTSW	14	61204273	missense	probably damaging	1.00
R4717:Sacs	UTSW	14	61212855	missense	probably damaging	1.00
R4777:Sacs	UTSW	14	61211809	missense	probably damaging	1.00
R4888:Sacs	UTSW	14	61212198	missense	probably damaging	1.00
R4913:Sacs	UTSW	14	61213797	missense	probably benign	0.17
R4973:Sacs	UTSW	14	61213122	missense	probably damaging	1.00
R5090:Sacs	UTSW	14	61205253	missense	probably damaging	1.00
R5243:Sacs	UTSW	14	61205957	nonsense	probably null
R5292:Sacs	UTSW	14	61211983	missense	probably damaging	1.00
R5308:Sacs	UTSW	14	61192400	missense	probably benign	0.21
R5337:Sacs	UTSW	14	61193514	intron	probably benign
R5502:Sacs	UTSW	14	61206100	missense	probably damaging	1.00
R5586:Sacs	UTSW	14	61206441	nonsense	probably null
R5692:Sacs	UTSW	14	61207839	missense	probably benign	0.00
R5725:Sacs	UTSW	14	61211110	missense	probably damaging	1.00
R5854:Sacs	UTSW	14	61211547	missense	probably damaging	1.00
R5959:Sacs	UTSW	14	61212400	missense	probably damaging	0.99
R5960:Sacs	UTSW	14	61208695	missense	probably benign	0.30
R5968:Sacs	UTSW	14	61189629	missense	probably damaging	0.99
R5983:Sacs	UTSW	14	61205199	missense	probably damaging	1.00
R5992:Sacs	UTSW	14	61205543	missense	probably damaging	1.00
R6076:Sacs	UTSW	14	61204536	nonsense	probably null
R6175:Sacs	UTSW	14	61212826	missense	possibly damaging	0.82
R6347:Sacs	UTSW	14	61211160	missense	probably damaging	1.00
R6357:Sacs	UTSW	14	61208824	missense	possibly damaging	0.47
R6415:Sacs	UTSW	14	61205359	missense	probably damaging	1.00
R6469:Sacs	UTSW	14	61191248	missense	probably damaging	1.00
R6503:Sacs	UTSW	14	61211361	missense	probably benign	0.00
R6523:Sacs	UTSW	14	61202961	missense	probably damaging	0.99
R6615:Sacs	UTSW	14	61208934	missense	probably benign	0.15
R6729:Sacs	UTSW	14	61210518	missense	probably damaging	1.00
R6731:Sacs	UTSW	14	61180700	splice site	probably null
R6797:Sacs	UTSW	14	61213073	missense	probably damaging	1.00
R6852:Sacs	UTSW	14	61179288	missense	possibly damaging	0.87
R6922:Sacs	UTSW	14	61211425	missense	probably damaging	1.00
R7023:Sacs	UTSW	14	61208815	missense	probably benign	0.04
R7047:Sacs	UTSW	14	61213002	missense	probably damaging	1.00
R7051:Sacs	UTSW	14	61208928	missense	probably benign	0.25
R7069:Sacs	UTSW	14	61212496	missense	probably damaging	1.00
R7082:Sacs	UTSW	14	61210517	missense	possibly damaging	0.94
R7108:Sacs	UTSW	14	61211009	nonsense	probably null
R7122:Sacs	UTSW	14	61210396	missense	probably damaging	1.00
R7194:Sacs	UTSW	14	61210089	missense	possibly damaging	0.95
R7214:Sacs	UTSW	14	61191792	missense	probably benign
R7221:Sacs	UTSW	14	61208806	missense	probably damaging	0.99
R7274:Sacs	UTSW	14	61214081	missense	possibly damaging	0.88
R7344:Sacs	UTSW	14	61207444	missense	possibly damaging	0.81
R7440:Sacs	UTSW	14	61191605	missense	probably benign	0.10
R7474:Sacs	UTSW	14	61211178	missense	probably benign	0.04
R7512:Sacs	UTSW	14	61204430	missense	probably benign	0.04
R7641:Sacs	UTSW	14	61202871	missense	probably damaging	0.97
R7649:Sacs	UTSW	14	61203228	missense	possibly damaging	0.53
R7703:Sacs	UTSW	14	61206090	missense	possibly damaging	0.81
R7792:Sacs	UTSW	14	61209773	missense	probably benign	0.00
R7805:Sacs	UTSW	14	61203591	missense	not run
R7822:Sacs	UTSW	14	61192203	missense	probably benign	0.03
R7882:Sacs	UTSW	14	61207071	missense	probably benign	0.02
R7932:Sacs	UTSW	14	61204878	missense	probably damaging	0.99
R8031:Sacs	UTSW	14	61204191	missense	probably damaging	0.96
R8064:Sacs	UTSW	14	61192175	missense	possibly damaging	0.92
R8083:Sacs	UTSW	14	61210717	missense	possibly damaging	0.77
R8204:Sacs	UTSW	14	61212948	missense	probably damaging	0.96
R8293:Sacs	UTSW	14	61191099	missense	probably damaging	0.99
R8316:Sacs	UTSW	14	61189619	missense	possibly damaging	0.84
R8393:Sacs	UTSW	14	61173206	start codon destroyed	probably null	0.06
R8434:Sacs	UTSW	14	61213187	nonsense	probably null
R8482:Sacs	UTSW	14	61202955	missense	probably benign
R8497:Sacs	UTSW	14	61192253	missense	probably benign	0.00
R8557:Sacs	UTSW	14	61207276	missense	probably damaging	1.00
X0067:Sacs	UTSW	14	61208019	missense	probably damaging	1.00
Z1176:Sacs	UTSW	14	61210830	nonsense	probably null
Z1176:Sacs	UTSW	14	61213200	missense	probably damaging	1.00
Z1177:Sacs	UTSW	14	61191551	missense	possibly damaging	0.48
Z1177:Sacs	UTSW	14	61207981	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- CTTAATTGCTATGCTGGGATGC -3'
(R):5'- GGAGCTTTCATCAGGCCTTGAG -3'

Sequencing Primer
(F):5'- GCTGGGATGCAATGACATTTAC -3'
(R):5'- CAGGCCTTGAGAACTTGTACAGATC -3'

Posted On

2016-05-10