Incidental Mutation 'R4986:Slain1'
ID385890
Institutional Source Beutler Lab
Gene Symbol Slain1
Ensembl Gene ENSMUSG00000055717
Gene NameSLAIN motif family, member 1
Synonyms9630044O09Rik
MMRRC Submission 042580-MU
Accession Numbers

NCBI RefSeq: NM_198014.2; MGI:2145578

Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R4986 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location103650228-103704907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103688105 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 296 (R296S)
Ref Sequence ENSEMBL: ENSMUSP00000070592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069443] [ENSMUST00000160805] [ENSMUST00000162818]
Predicted Effect probably damaging
Transcript: ENSMUST00000069443
AA Change: R296S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070592
Gene: ENSMUSG00000055717
AA Change: R296S

DomainStartEndE-ValueType
SCOP:d1gw5a_ 13 72 2e-3 SMART
low complexity region 91 102 N/A INTRINSIC
low complexity region 105 120 N/A INTRINSIC
low complexity region 129 173 N/A INTRINSIC
Pfam:SLAIN 185 237 6.7e-19 PFAM
Pfam:SLAIN 230 579 1.7e-138 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159456
AA Change: R136S

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125685
Gene: ENSMUSG00000055717
AA Change: R136S

DomainStartEndE-ValueType
Pfam:SLAIN 15 420 4e-141 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160117
Predicted Effect probably benign
Transcript: ENSMUST00000160805
AA Change: R249S

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125128
Gene: ENSMUSG00000055717
AA Change: R249S

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 32 76 N/A INTRINSIC
Pfam:SLAIN 88 532 2.6e-144 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162818
AA Change: R130S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123742
Gene: ENSMUSG00000055717
AA Change: R130S

DomainStartEndE-ValueType
Pfam:SLAIN 19 212 2e-86 PFAM
Meta Mutation Damage Score 0.1494 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.2%
Validation Efficiency 95% (41/43)
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A T 14: 49,751,654 D619E probably damaging Het
Abcc9 A T 6: 142,627,591 C1005S probably benign Het
Ccdc34 T C 2: 110,017,869 M1T probably null Het
Ceacam5 T A 7: 17,757,833 N709K possibly damaging Het
Ces2f G A 8: 104,952,025 S298N probably benign Het
Defa30 T A 8: 21,135,416 Y65* probably null Het
Dock3 A C 9: 106,931,983 C1314G probably damaging Het
Emc2 A G 15: 43,511,784 M226V probably benign Het
Fat3 T C 9: 15,998,340 Y2122C probably damaging Het
Gad1 A G 2: 70,600,693 D560G probably benign Het
Gm9944 T C 4: 144,453,190 probably benign Het
Gpr137c A T 14: 45,246,286 probably null Het
Igf2bp2 C T 16: 22,070,306 probably null Het
Igsf10 T C 3: 59,328,606 T1385A probably benign Het
Itpr2 T A 6: 146,240,342 N1734I probably damaging Het
Kbtbd6 A G 14: 79,452,609 H248R probably damaging Het
Macf1 C T 4: 123,391,121 R5650Q probably damaging Het
Mdh1 A G 11: 21,558,545 F266L possibly damaging Het
Mecom G T 3: 29,980,699 P466Q probably damaging Het
Muc20 A G 16: 32,777,635 probably benign Het
Olfr1151 T A 2: 87,857,514 L113Q probably damaging Het
Olfr1265 A T 2: 90,037,428 N170Y probably damaging Het
Osmr A G 15: 6,816,580 probably null Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Sacs T A 14: 61,213,043 Y4179* probably null Het
Sept11 T C 5: 93,161,241 V203A probably damaging Het
Skint9 T A 4: 112,391,713 T173S probably benign Het
Slc36a3 T A 11: 55,146,766 *93C probably null Het
Sp110 G A 1: 85,591,760 P116S probably benign Het
Srl T C 16: 4,496,782 Y332C probably benign Het
Ubtf G A 11: 102,314,174 H95Y probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Ybx1 C T 4: 119,282,430 V123I probably damaging Het
Zfp944 A T 17: 22,339,230 H345Q probably damaging Het
Zfp993 T A 4: 146,657,557 F113I probably benign Het
Other mutations in Slain1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02248:Slain1 APN 14 103685777 missense probably damaging 1.00
P0016:Slain1 UTSW 14 103685674 missense probably benign 0.37
R0113:Slain1 UTSW 14 103685825 splice site probably benign
R0547:Slain1 UTSW 14 103695275 missense probably damaging 1.00
R2113:Slain1 UTSW 14 103650846 missense possibly damaging 0.81
R6368:Slain1 UTSW 14 103656955 missense probably benign 0.03
R6899:Slain1 UTSW 14 103650779 missense possibly damaging 0.93
R7355:Slain1 UTSW 14 103702576 frame shift probably null
R7442:Slain1 UTSW 14 103685714 missense probably damaging 1.00
R7498:Slain1 UTSW 14 103655993 splice site probably null
R7910:Slain1 UTSW 14 103685764 missense probably damaging 1.00
R8043:Slain1 UTSW 14 103688346 missense possibly damaging 0.95
Z1177:Slain1 UTSW 14 103684234 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTTCACAGCCATGGGGATATAG -3'
(R):5'- TGCTGGAGAAAGTCTGTGAG -3'

Sequencing Primer
(F):5'- TGACCTAACATTAGATATGTGACTGG -3'
(R):5'- AAAGTCTGTGAGTGGGGGATCC -3'
Posted On2016-05-10