Mutagenetix > Incidental Mutations

Incidental Mutation 'R4986:Osmr'

385891

Institutional Source

Beutler Lab

Gene Symbol

Osmr

Ensembl Gene

ENSMUSG00000022146

Gene Name

oncostatin M receptor

Synonyms

OSMRB

MMRRC Submission

042580-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.054) question?

Stock #

R4986 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

6813577-6874969 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 6816580 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000135204 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022746] [ENSMUST00000176826]

Predicted Effect

probably null
Transcript: ENSMUST00000022746

SMART Domains

Protein: ENSMUSP00000022746
Gene: ENSMUSG00000022146

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	26	35	N/A	INTRINSIC
Blast:FN3	234	317	9e-38	BLAST
FN3	330	412	6.25e-3	SMART
FN3	427	512	2.75e0	SMART
FN3	523	607	7.02e1	SMART
FN3	619	720	3.17e-4	SMART
transmembrane domain	736	758	N/A	INTRINSIC
low complexity region	776	787	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176554

Predicted Effect

probably null
Transcript: ENSMUST00000176826

SMART Domains

Protein: ENSMUSP00000135204
Gene: ENSMUSG00000022146

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	26	35	N/A	INTRINSIC
Blast:FN3	234	317	9e-38	BLAST
FN3	330	412	6.25e-3	SMART
FN3	427	512	2.75e0	SMART
FN3	523	606	2.77e1	SMART
FN3	618	719	3.17e-4	SMART
transmembrane domain	735	757	N/A	INTRINSIC
low complexity region	775	786	N/A	INTRINSIC

Meta Mutation Damage Score

0.9476

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.2%

Validation Efficiency

95% (41/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I cytokine receptor family. The encoded protein heterodimerizes with interleukin 6 signal transducer to form the type II oncostatin M receptor and with interleukin 31 receptor A to form the interleukin 31 receptor, and thus transduces oncostatin M and interleukin 31 induced signaling events. Mutations in this gene have been associated with familial primary localized cutaneous amyloidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit anemia, decreased hematocrit, and reduced erythroid progenitor, erythrocyte, platelet, and megakaryocyte cells. Homozygotes also show increased susceptibility to diet-induced obesity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	A	T	14: 49,751,654	D619E	probably damaging	Het
Abcc9	A	T	6: 142,627,591	C1005S	probably benign	Het
Ccdc34	T	C	2: 110,017,869	M1T	probably null	Het
Ceacam5	T	A	7: 17,757,833	N709K	possibly damaging	Het
Ces2f	G	A	8: 104,952,025	S298N	probably benign	Het
Defa30	T	A	8: 21,135,416	Y65*	probably null	Het
Dock3	A	C	9: 106,931,983	C1314G	probably damaging	Het
Emc2	A	G	15: 43,511,784	M226V	probably benign	Het
Fat3	T	C	9: 15,998,340	Y2122C	probably damaging	Het
Gad1	A	G	2: 70,600,693	D560G	probably benign	Het
Gm9944	T	C	4: 144,453,190		probably benign	Het
Gpr137c	A	T	14: 45,246,286		probably null	Het
Igf2bp2	C	T	16: 22,070,306		probably null	Het
Igsf10	T	C	3: 59,328,606	T1385A	probably benign	Het
Itpr2	T	A	6: 146,240,342	N1734I	probably damaging	Het
Kbtbd6	A	G	14: 79,452,609	H248R	probably damaging	Het
Macf1	C	T	4: 123,391,121	R5650Q	probably damaging	Het
Mdh1	A	G	11: 21,558,545	F266L	possibly damaging	Het
Mecom	G	T	3: 29,980,699	P466Q	probably damaging	Het
Muc20	A	G	16: 32,777,635		probably benign	Het
Olfr1151	T	A	2: 87,857,514	L113Q	probably damaging	Het
Olfr1265	A	T	2: 90,037,428	N170Y	probably damaging	Het
Rrs1	G	A	1: 9,545,767	E82K	probably damaging	Het
Sacs	T	A	14: 61,213,043	Y4179*	probably null	Het
Sept11	T	C	5: 93,161,241	V203A	probably damaging	Het
Skint9	T	A	4: 112,391,713	T173S	probably benign	Het
Slain1	A	T	14: 103,688,105	R296S	probably damaging	Het
Slc36a3	T	A	11: 55,146,766	*93C	probably null	Het
Sp110	G	A	1: 85,591,760	P116S	probably benign	Het
Srl	T	C	16: 4,496,782	Y332C	probably benign	Het
Ubtf	G	A	11: 102,314,174	H95Y	probably benign	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Wdfy3	C	T	5: 101,943,119	D532N	probably benign	Het
Ybx1	C	T	4: 119,282,430	V123I	probably damaging	Het
Zfp944	A	T	17: 22,339,230	H345Q	probably damaging	Het
Zfp993	T	A	4: 146,657,557	F113I	probably benign	Het

Other mutations in Osmr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Osmr	APN	15	6844445	nonsense	probably null
IGL00335:Osmr	APN	15	6837023	missense	probably benign	0.00
IGL00497:Osmr	APN	15	6847066	missense	probably benign	0.26
IGL00510:Osmr	APN	15	6823631	nonsense	probably null
IGL00811:Osmr	APN	15	6815666	missense	probably benign	0.28
IGL00959:Osmr	APN	15	6824605	missense	probably benign	0.12
IGL01115:Osmr	APN	15	6847201	splice site	probably benign
IGL01307:Osmr	APN	15	6844427	missense	probably damaging	1.00
IGL01330:Osmr	APN	15	6842028	missense	probably damaging	1.00
IGL01633:Osmr	APN	15	6824604	missense	probably damaging	1.00
IGL01780:Osmr	APN	15	6828663	missense	probably benign	0.00
IGL02164:Osmr	APN	15	6842048	missense	probably damaging	0.99
IGL02207:Osmr	APN	15	6847147	missense	probably benign	0.07
IGL02338:Osmr	APN	15	6837729	nonsense	probably null
IGL02350:Osmr	APN	15	6828663	missense	probably benign	0.00
IGL02357:Osmr	APN	15	6828663	missense	probably benign	0.00
IGL02545:Osmr	APN	15	6823579	missense	probably damaging	0.98
IGL02619:Osmr	APN	15	6841994	missense	probably damaging	1.00
IGL02685:Osmr	APN	15	6815573	missense	probably benign	0.00
IGL02959:Osmr	APN	15	6815897	missense	possibly damaging	0.93
IGL03303:Osmr	APN	15	6842808	missense	probably benign	0.03
FR4548:Osmr	UTSW	15	6837703	small insertion	probably benign
FR4737:Osmr	UTSW	15	6837706	nonsense	probably null
R0149:Osmr	UTSW	15	6841951	critical splice donor site	probably null
R0361:Osmr	UTSW	15	6841951	critical splice donor site	probably null
R0492:Osmr	UTSW	15	6824518	missense	probably damaging	1.00
R0538:Osmr	UTSW	15	6841938	splice site	probably benign
R0585:Osmr	UTSW	15	6837793	missense	probably benign
R0980:Osmr	UTSW	15	6852440	missense	probably benign	0.00
R1221:Osmr	UTSW	15	6823561	nonsense	probably null
R1922:Osmr	UTSW	15	6844367	missense	possibly damaging	0.67
R2067:Osmr	UTSW	15	6815415	missense	probably benign	0.00
R2136:Osmr	UTSW	15	6852462	missense	probably damaging	1.00
R2156:Osmr	UTSW	15	6844410	missense	probably benign	0.04
R3683:Osmr	UTSW	15	6837053	missense	possibly damaging	0.95
R3735:Osmr	UTSW	15	6822080	missense	probably damaging	1.00
R3736:Osmr	UTSW	15	6822080	missense	probably damaging	1.00
R4011:Osmr	UTSW	15	6824533	missense	probably benign	0.01
R4175:Osmr	UTSW	15	6852546	missense	probably damaging	1.00
R4555:Osmr	UTSW	15	6815720	missense	possibly damaging	0.73
R4581:Osmr	UTSW	15	6842894	missense	probably benign	0.00
R4751:Osmr	UTSW	15	6842852	missense	probably damaging	1.00
R4758:Osmr	UTSW	15	6852555	missense	probably benign	0.23
R4997:Osmr	UTSW	15	6815639	missense	probably benign	0.25
R5077:Osmr	UTSW	15	6844393	nonsense	probably null
R5093:Osmr	UTSW	15	6821079	missense	probably damaging	0.96
R5120:Osmr	UTSW	15	6827275	missense	probably benign	0.16
R5331:Osmr	UTSW	15	6842881	missense	probably damaging	1.00
R5812:Osmr	UTSW	15	6837059	missense	probably damaging	0.99
R5819:Osmr	UTSW	15	6815787	missense	probably benign	0.00
R5876:Osmr	UTSW	15	6821047	missense	probably benign	0.07
R5986:Osmr	UTSW	15	6844453	missense	probably benign	0.36
R6018:Osmr	UTSW	15	6815795	missense	probably damaging	1.00
R6164:Osmr	UTSW	15	6860352	missense	probably benign	0.00
R6217:Osmr	UTSW	15	6823566	missense	probably damaging	1.00
R6312:Osmr	UTSW	15	6823638	missense	probably damaging	1.00
R6349:Osmr	UTSW	15	6821063	missense	probably benign	0.00
R6898:Osmr	UTSW	15	6815883	missense	probably damaging	0.97
R7139:Osmr	UTSW	15	6821088	missense	possibly damaging	0.79
R7412:Osmr	UTSW	15	6823567	missense	probably damaging	1.00
R7527:Osmr	UTSW	15	6827122	missense	probably damaging	1.00
R7630:Osmr	UTSW	15	6816971	missense	possibly damaging	0.53
R7730:Osmr	UTSW	15	6824482	missense	probably damaging	1.00
R7990:Osmr	UTSW	15	6852467	missense	possibly damaging	0.87
R8094:Osmr	UTSW	15	6815621	missense	possibly damaging	0.64
R8187:Osmr	UTSW	15	6821004	missense	probably damaging	1.00
R8260:Osmr	UTSW	15	6815416	missense	probably benign	0.41
R8366:Osmr	UTSW	15	6820954	missense	possibly damaging	0.82
RF040:Osmr	UTSW	15	6837701	small insertion	probably benign
RF055:Osmr	UTSW	15	6837700	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- CCAAGATGAGTTCTTTTCTGTCAC -3'
(R):5'- GTTGACAAGCTTGCCTTCTGG -3'

Sequencing Primer
(F):5'- AGATGAGTTCTTTTCTGTCACTTACC -3'
(R):5'- AAGCTTGCCTTCTGGGTCAC -3'

Posted On

2016-05-10