Incidental Mutation 'R4986:Srl'
ID385893
Institutional Source Beutler Lab
Gene Symbol Srl
Ensembl Gene ENSMUSG00000022519
Gene Namesarcalumenin
Synonymssarcalumenin, 9830004M20Rik, sar
MMRRC Submission 042580-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4986 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location4480216-4541816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4496782 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 332 (Y332C)
Ref Sequence ENSEMBL: ENSMUSP00000023161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023161] [ENSMUST00000090500]
Predicted Effect probably benign
Transcript: ENSMUST00000023161
AA Change: Y332C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000023161
Gene: ENSMUSG00000022519
AA Change: Y332C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 111 125 N/A INTRINSIC
low complexity region 129 144 N/A INTRINSIC
low complexity region 283 300 N/A INTRINSIC
low complexity region 348 374 N/A INTRINSIC
low complexity region 379 396 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
Pfam:EHD_N 496 528 1.7e-13 PFAM
Pfam:MMR_HSR1 532 693 1.1e-8 PFAM
Pfam:Dynamin_N 533 694 8.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090500
SMART Domains Protein: ENSMUSP00000087986
Gene: ENSMUSG00000022519

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MMR_HSR1 94 255 4e-12 PFAM
Pfam:Dynamin_N 95 256 1.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133440
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230817
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.2%
Validation Efficiency 95% (41/43)
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit impaired calcium store functions in skeletal and cardiac muscle cells resulting in slow contraction and relaxation phases. Muscle also exhibits enhanced resistance to fatigue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A T 14: 49,751,654 D619E probably damaging Het
Abcc9 A T 6: 142,627,591 C1005S probably benign Het
Ccdc34 T C 2: 110,017,869 M1T probably null Het
Ceacam5 T A 7: 17,757,833 N709K possibly damaging Het
Ces2f G A 8: 104,952,025 S298N probably benign Het
Defa30 T A 8: 21,135,416 Y65* probably null Het
Dock3 A C 9: 106,931,983 C1314G probably damaging Het
Emc2 A G 15: 43,511,784 M226V probably benign Het
Fat3 T C 9: 15,998,340 Y2122C probably damaging Het
Gad1 A G 2: 70,600,693 D560G probably benign Het
Gm9944 T C 4: 144,453,190 probably benign Het
Gpr137c A T 14: 45,246,286 probably null Het
Igf2bp2 C T 16: 22,070,306 probably null Het
Igsf10 T C 3: 59,328,606 T1385A probably benign Het
Itpr2 T A 6: 146,240,342 N1734I probably damaging Het
Kbtbd6 A G 14: 79,452,609 H248R probably damaging Het
Macf1 C T 4: 123,391,121 R5650Q probably damaging Het
Mdh1 A G 11: 21,558,545 F266L possibly damaging Het
Mecom G T 3: 29,980,699 P466Q probably damaging Het
Muc20 A G 16: 32,777,635 probably benign Het
Olfr1151 T A 2: 87,857,514 L113Q probably damaging Het
Olfr1265 A T 2: 90,037,428 N170Y probably damaging Het
Osmr A G 15: 6,816,580 probably null Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Sacs T A 14: 61,213,043 Y4179* probably null Het
Sept11 T C 5: 93,161,241 V203A probably damaging Het
Skint9 T A 4: 112,391,713 T173S probably benign Het
Slain1 A T 14: 103,688,105 R296S probably damaging Het
Slc36a3 T A 11: 55,146,766 *93C probably null Het
Sp110 G A 1: 85,591,760 P116S probably benign Het
Ubtf G A 11: 102,314,174 H95Y probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Ybx1 C T 4: 119,282,430 V123I probably damaging Het
Zfp944 A T 17: 22,339,230 H345Q probably damaging Het
Zfp993 T A 4: 146,657,557 F113I probably benign Het
Other mutations in Srl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00803:Srl APN 16 4483220 missense probably null 1.00
IGL01296:Srl APN 16 4497682 missense probably damaging 0.99
IGL02006:Srl APN 16 4497286 missense probably benign 0.23
IGL02255:Srl APN 16 4487558 missense probably damaging 1.00
IGL02583:Srl APN 16 4492380 missense possibly damaging 0.69
R0550:Srl UTSW 16 4487565 missense probably damaging 1.00
R0559:Srl UTSW 16 4496978 missense probably benign 0.01
R1933:Srl UTSW 16 4492350 missense probably damaging 0.99
R2093:Srl UTSW 16 4523032 missense unknown
R2298:Srl UTSW 16 4482898 missense probably damaging 1.00
R4093:Srl UTSW 16 4497452 missense possibly damaging 0.93
R4798:Srl UTSW 16 4492358 missense possibly damaging 0.51
R5088:Srl UTSW 16 4482769 missense probably damaging 1.00
R5177:Srl UTSW 16 4496403 critical splice donor site probably null
R5260:Srl UTSW 16 4482895 nonsense probably null
R5988:Srl UTSW 16 4523028 missense unknown
R6875:Srl UTSW 16 4482831 missense probably benign 0.02
R6946:Srl UTSW 16 4482559 missense probably benign 0.00
R7221:Srl UTSW 16 4482947 missense probably damaging 0.99
R7262:Srl UTSW 16 4497551 missense probably damaging 0.96
R8307:Srl UTSW 16 4497145 missense probably benign 0.01
X0023:Srl UTSW 16 4492368 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCTTCCACATCAAGCTGGGG -3'
(R):5'- TACATGCAGCCTCTGACAC -3'

Sequencing Primer
(F):5'- CATGTCCTGTGGCTCCTGG -3'
(R):5'- ACACGGCATCTTCTGGAGTAG -3'
Posted On2016-05-10