Incidental Mutation 'R4987:Fmo5'
ID385903
Institutional Source Beutler Lab
Gene Symbol Fmo5
Ensembl Gene ENSMUSG00000028088
Gene Nameflavin containing monooxygenase 5
Synonyms
MMRRC Submission 042581-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R4987 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location97628804-97655282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97635578 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 68 (M68T)
Ref Sequence ENSEMBL: ENSMUSP00000102665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029729] [ENSMUST00000107049] [ENSMUST00000107050]
Predicted Effect probably benign
Transcript: ENSMUST00000029729
AA Change: M68T

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029729
Gene: ENSMUSG00000028088
AA Change: M68T

DomainStartEndE-ValueType
Pfam:FMO-like 3 533 9.7e-280 PFAM
Pfam:Pyr_redox_2 5 224 3.4e-8 PFAM
Pfam:Pyr_redox_3 7 221 2.2e-21 PFAM
Pfam:NAD_binding_8 8 69 1.7e-6 PFAM
Pfam:K_oxygenase 81 223 9.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107049
AA Change: M68T

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102664
Gene: ENSMUSG00000028088
AA Change: M68T

DomainStartEndE-ValueType
Pfam:FMO-like 3 533 9.7e-280 PFAM
Pfam:Pyr_redox_2 5 224 3.4e-8 PFAM
Pfam:Pyr_redox_3 7 221 2.2e-21 PFAM
Pfam:NAD_binding_8 8 69 1.7e-6 PFAM
Pfam:K_oxygenase 81 223 9.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107050
AA Change: M68T

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102665
Gene: ENSMUSG00000028088
AA Change: M68T

DomainStartEndE-ValueType
Pfam:FMO-like 3 533 9.7e-280 PFAM
Pfam:Pyr_redox_2 4 228 8.5e-11 PFAM
Pfam:Pyr_redox_3 7 221 4.7e-11 PFAM
Pfam:NAD_binding_8 8 70 3.5e-7 PFAM
Pfam:K_oxygenase 80 222 2.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140283
Meta Mutation Damage Score 0.1339 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.3%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metabolic N-oxidation of the diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man resulting in a small subpopulation with reduced TMA N-oxidation capacity resulting in fish odor syndrome Trimethylaminuria. Three forms of the enzyme, FMO1 found in fetal liver, FMO2 found in adult liver, and FMO3 are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show an age-related lean phenotype despite increased food intake, lower plasma levels of glucose and cholesterol, decreased fat storage in WAT, altered fatty acid oxidation, increased energy expenditure and respiratory quotient but normal physical activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T C 9: 92,354,584 S175P probably damaging Het
Acrbp T C 6: 125,053,762 S249P probably benign Het
Adcy4 A G 14: 55,773,477 V661A probably benign Het
Ahdc1 T G 4: 133,064,320 H957Q possibly damaging Het
Atp10b A G 11: 43,151,613 probably benign Het
B3gnt5 A T 16: 19,769,202 N57I probably damaging Het
BC067074 T C 13: 113,318,101 V227A probably benign Het
Brms1l T A 12: 55,866,015 D264E probably benign Het
Camk1g T A 1: 193,348,475 N309Y probably damaging Het
Chl1 A G 6: 103,674,977 T285A probably damaging Het
Dennd1c G T 17: 57,073,852 T200K probably damaging Het
Dpysl3 C A 18: 43,328,427 M566I probably benign Het
Dscam A T 16: 96,697,521 D985E probably benign Het
Gm26996 A G 6: 130,590,996 unknown Het
Gm9991 A T 1: 90,675,416 noncoding transcript Het
Gzmc T A 14: 56,231,540 I241L probably damaging Het
Hibadh A T 6: 52,622,895 S105R probably damaging Het
Krt83 A G 15: 101,487,009 I402T probably benign Het
Krtap31-2 A G 11: 99,936,570 D76G possibly damaging Het
Lin9 A G 1: 180,668,764 S249G probably damaging Het
Lpcat1 T A 13: 73,489,103 probably null Het
Mfap4 A G 11: 61,486,082 I46V probably benign Het
Nos1 T C 5: 117,926,533 probably null Het
Nostrin A G 2: 69,156,431 M107V probably benign Het
Nutm2 C T 13: 50,472,343 T322I possibly damaging Het
Olfr1080 A C 2: 86,553,235 D296E probably null Het
Pcdha12 T A 18: 37,021,551 V441E probably damaging Het
Plcd4 A G 1: 74,547,959 probably benign Het
Ppme1 T C 7: 100,345,071 D145G probably benign Het
Rbm25 T C 12: 83,677,856 V793A probably damaging Het
Rlbp1 A T 7: 79,380,131 V118E probably damaging Het
Serinc2 C T 4: 130,263,027 probably null Het
Slc25a32 A G 15: 39,100,019 C136R possibly damaging Het
Smco2 A G 6: 146,856,092 D48G possibly damaging Het
Trpv4 T C 5: 114,622,732 D846G probably benign Het
Ubr1 A T 2: 120,963,566 L46I probably benign Het
Wdsub1 A G 2: 59,870,393 probably benign Het
Zp3 T A 5: 135,987,505 C320* probably null Het
Other mutations in Fmo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Fmo5 APN 3 97651568 missense probably benign 0.19
IGL01926:Fmo5 APN 3 97637481 missense probably damaging 1.00
IGL03062:Fmo5 APN 3 97635593 missense probably damaging 1.00
IGL03215:Fmo5 APN 3 97641806 missense probably benign
IGL03323:Fmo5 APN 3 97639007 splice site probably null
PIT4445001:Fmo5 UTSW 3 97651528 missense probably benign 0.30
R0133:Fmo5 UTSW 3 97645636 missense probably damaging 0.99
R0207:Fmo5 UTSW 3 97645681 missense probably damaging 1.00
R0570:Fmo5 UTSW 3 97629140 missense probably damaging 1.00
R2014:Fmo5 UTSW 3 97635682 missense possibly damaging 0.56
R2093:Fmo5 UTSW 3 97645878 missense probably benign 0.41
R3087:Fmo5 UTSW 3 97641695 missense probably damaging 1.00
R3694:Fmo5 UTSW 3 97645914 missense probably damaging 1.00
R3764:Fmo5 UTSW 3 97645717 missense probably damaging 1.00
R4864:Fmo5 UTSW 3 97645879 missense probably damaging 1.00
R5152:Fmo5 UTSW 3 97641762 missense probably benign 0.00
R5304:Fmo5 UTSW 3 97651622 missense probably damaging 1.00
R5306:Fmo5 UTSW 3 97641760 missense probably benign 0.00
R5563:Fmo5 UTSW 3 97638891 missense probably damaging 1.00
R5888:Fmo5 UTSW 3 97641725 missense probably benign 0.10
R6352:Fmo5 UTSW 3 97645675 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ATAGATGCAACATTGTAGGTGTGTG -3'
(R):5'- AGTCCTGACAGGTGACACAG -3'

Sequencing Primer
(F):5'- GTGTGTGTTTCACTTAGATACGC -3'
(R):5'- GAAGCTTCGTAATTCATTGACCCG -3'
Posted On2016-05-10