Incidental Mutation 'R4987:Smco2'
ID385912
Institutional Source Beutler Lab
Gene Symbol Smco2
Ensembl Gene ENSMUSG00000030292
Gene Namesingle-pass membrane protein with coiled-coil domains 2
Synonyms1700023A16Rik
MMRRC Submission 042581-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4987 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location146850104-146871406 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146856092 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 48 (D48G)
Ref Sequence ENSEMBL: ENSMUSP00000032433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032433]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032433
AA Change: D48G

PolyPhen 2 Score 0.591 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032433
Gene: ENSMUSG00000030292
AA Change: D48G

DomainStartEndE-ValueType
Pfam:TMCO5 1 121 3.6e-14 PFAM
Pfam:TMCO5 142 346 2.5e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205239
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.3%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T C 9: 92,354,584 S175P probably damaging Het
Acrbp T C 6: 125,053,762 S249P probably benign Het
Adcy4 A G 14: 55,773,477 V661A probably benign Het
Ahdc1 T G 4: 133,064,320 H957Q possibly damaging Het
Atp10b A G 11: 43,151,613 probably benign Het
B3gnt5 A T 16: 19,769,202 N57I probably damaging Het
BC067074 T C 13: 113,318,101 V227A probably benign Het
Brms1l T A 12: 55,866,015 D264E probably benign Het
Camk1g T A 1: 193,348,475 N309Y probably damaging Het
Chl1 A G 6: 103,674,977 T285A probably damaging Het
Dennd1c G T 17: 57,073,852 T200K probably damaging Het
Dpysl3 C A 18: 43,328,427 M566I probably benign Het
Dscam A T 16: 96,697,521 D985E probably benign Het
Fmo5 T C 3: 97,635,578 M68T probably benign Het
Gm26996 A G 6: 130,590,996 unknown Het
Gm9991 A T 1: 90,675,416 noncoding transcript Het
Gzmc T A 14: 56,231,540 I241L probably damaging Het
Hibadh A T 6: 52,622,895 S105R probably damaging Het
Krt83 A G 15: 101,487,009 I402T probably benign Het
Krtap31-2 A G 11: 99,936,570 D76G possibly damaging Het
Lin9 A G 1: 180,668,764 S249G probably damaging Het
Lpcat1 T A 13: 73,489,103 probably null Het
Mfap4 A G 11: 61,486,082 I46V probably benign Het
Nos1 T C 5: 117,926,533 probably null Het
Nostrin A G 2: 69,156,431 M107V probably benign Het
Nutm2 C T 13: 50,472,343 T322I possibly damaging Het
Olfr1080 A C 2: 86,553,235 D296E probably null Het
Pcdha12 T A 18: 37,021,551 V441E probably damaging Het
Plcd4 A G 1: 74,547,959 probably benign Het
Ppme1 T C 7: 100,345,071 D145G probably benign Het
Rbm25 T C 12: 83,677,856 V793A probably damaging Het
Rlbp1 A T 7: 79,380,131 V118E probably damaging Het
Serinc2 C T 4: 130,263,027 probably null Het
Slc25a32 A G 15: 39,100,019 C136R possibly damaging Het
Trpv4 T C 5: 114,622,732 D846G probably benign Het
Ubr1 A T 2: 120,963,566 L46I probably benign Het
Wdsub1 A G 2: 59,870,393 probably benign Het
Zp3 T A 5: 135,987,505 C320* probably null Het
Other mutations in Smco2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01959:Smco2 APN 6 146861710 missense probably benign 0.38
IGL03082:Smco2 APN 6 146860044 missense possibly damaging 0.52
R0256:Smco2 UTSW 6 146861746 missense probably damaging 1.00
R0402:Smco2 UTSW 6 146871135 critical splice acceptor site probably benign
R1144:Smco2 UTSW 6 146871140 critical splice acceptor site probably benign
R1335:Smco2 UTSW 6 146862087 intron probably benign
R2508:Smco2 UTSW 6 146859967 missense probably damaging 1.00
R4560:Smco2 UTSW 6 146871176 missense possibly damaging 0.94
R4701:Smco2 UTSW 6 146861942 intron probably benign
R5322:Smco2 UTSW 6 146871287 missense probably damaging 1.00
R6764:Smco2 UTSW 6 146871329 missense probably damaging 0.99
R7023:Smco2 UTSW 6 146858856 nonsense probably null
R7090:Smco2 UTSW 6 146871213 missense probably damaging 0.97
R7220:Smco2 UTSW 6 146858865 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATACCTGGAGCTGAGGTGTG -3'
(R):5'- TGCTTTCCCAGACACAAGGTG -3'

Sequencing Primer
(F):5'- TGTTCTATAGGTCTCCATTAGAATCG -3'
(R):5'- TTTCCCAGACACAAGGTGAGGTC -3'
Posted On2016-05-10