Incidental Mutation 'R4987:Ppme1'
ID385914
Institutional Source Beutler Lab
Gene Symbol Ppme1
Ensembl Gene ENSMUSG00000030718
Gene Nameprotein phosphatase methylesterase 1
Synonyms1110069N17Rik, PME-1, 2700017M01Rik
MMRRC Submission 042581-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4987 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location100326737-100372307 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100345071 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 145 (D145G)
Ref Sequence ENSEMBL: ENSMUSP00000032963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032963]
Predicted Effect probably benign
Transcript: ENSMUST00000032963
AA Change: D145G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000032963
Gene: ENSMUSG00000030718
AA Change: D145G

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:Hydrolase_4 73 199 5.2e-13 PFAM
Pfam:Abhydrolase_1 77 356 7.4e-17 PFAM
Pfam:Abhydrolase_5 78 259 1.3e-14 PFAM
Pfam:Abhydrolase_6 79 362 2.4e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207092
Predicted Effect probably benign
Transcript: ENSMUST00000207634
Meta Mutation Damage Score 0.1476 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.3%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein phosphatase methylesterase localized to the nucleus. The encoded protein acts on the protein phosphatase-2A catalytic subunit and supports the ERK pathway through dephosphorylation of regulatory proteins. It plays a role in malignant glioma progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
PHENOTYPE: Targeted disruption of this gene causes virtual loss of the demethylated form of phosphoprotein phosphatase 2A in the nervous system and peripheral tissues. Homozygous null mice fail to initiate normal breathing or suckling behavior and die within the first day of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T C 9: 92,354,584 S175P probably damaging Het
Acrbp T C 6: 125,053,762 S249P probably benign Het
Adcy4 A G 14: 55,773,477 V661A probably benign Het
Ahdc1 T G 4: 133,064,320 H957Q possibly damaging Het
Atp10b A G 11: 43,151,613 probably benign Het
B3gnt5 A T 16: 19,769,202 N57I probably damaging Het
BC067074 T C 13: 113,318,101 V227A probably benign Het
Brms1l T A 12: 55,866,015 D264E probably benign Het
Camk1g T A 1: 193,348,475 N309Y probably damaging Het
Chl1 A G 6: 103,674,977 T285A probably damaging Het
Dennd1c G T 17: 57,073,852 T200K probably damaging Het
Dpysl3 C A 18: 43,328,427 M566I probably benign Het
Dscam A T 16: 96,697,521 D985E probably benign Het
Fmo5 T C 3: 97,635,578 M68T probably benign Het
Gm26996 A G 6: 130,590,996 unknown Het
Gm9991 A T 1: 90,675,416 noncoding transcript Het
Gzmc T A 14: 56,231,540 I241L probably damaging Het
Hibadh A T 6: 52,622,895 S105R probably damaging Het
Krt83 A G 15: 101,487,009 I402T probably benign Het
Krtap31-2 A G 11: 99,936,570 D76G possibly damaging Het
Lin9 A G 1: 180,668,764 S249G probably damaging Het
Lpcat1 T A 13: 73,489,103 probably null Het
Mfap4 A G 11: 61,486,082 I46V probably benign Het
Nos1 T C 5: 117,926,533 probably null Het
Nostrin A G 2: 69,156,431 M107V probably benign Het
Nutm2 C T 13: 50,472,343 T322I possibly damaging Het
Olfr1080 A C 2: 86,553,235 D296E probably null Het
Pcdha12 T A 18: 37,021,551 V441E probably damaging Het
Plcd4 A G 1: 74,547,959 probably benign Het
Rbm25 T C 12: 83,677,856 V793A probably damaging Het
Rlbp1 A T 7: 79,380,131 V118E probably damaging Het
Serinc2 C T 4: 130,263,027 probably null Het
Slc25a32 A G 15: 39,100,019 C136R possibly damaging Het
Smco2 A G 6: 146,856,092 D48G possibly damaging Het
Trpv4 T C 5: 114,622,732 D846G probably benign Het
Ubr1 A T 2: 120,963,566 L46I probably benign Het
Wdsub1 A G 2: 59,870,393 probably benign Het
Zp3 T A 5: 135,987,505 C320* probably null Het
Other mutations in Ppme1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02138:Ppme1 APN 7 100333932 missense probably damaging 1.00
IGL02957:Ppme1 APN 7 100338440 missense possibly damaging 0.93
R0328:Ppme1 UTSW 7 100333975 splice site probably null
R3015:Ppme1 UTSW 7 100331877 missense probably damaging 1.00
R4042:Ppme1 UTSW 7 100341065 missense probably damaging 1.00
R4090:Ppme1 UTSW 7 100347837 missense possibly damaging 0.85
R5579:Ppme1 UTSW 7 100344975 missense probably damaging 1.00
R6035:Ppme1 UTSW 7 100354795 nonsense probably null
R6035:Ppme1 UTSW 7 100354795 nonsense probably null
R6374:Ppme1 UTSW 7 100341065 missense probably damaging 1.00
R6462:Ppme1 UTSW 7 100338392 missense probably benign 0.01
R7092:Ppme1 UTSW 7 100371822 start codon destroyed probably null 0.53
R7468:Ppme1 UTSW 7 100341862 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CAAGGTAATACCATACCAGGGG -3'
(R):5'- GCATAGATACTAGGGACCGTGC -3'

Sequencing Primer
(F):5'- GGGACCTCCTACAAATGACTG -3'
(R):5'- CGTGCATGCAGGCTTACATAG -3'
Posted On2016-05-10