Incidental Mutation 'R4987:Krt83'
ID385927
Institutional Source Beutler Lab
Gene Symbol Krt83
Ensembl Gene ENSMUSG00000047641
Gene Namekeratin 83
SynonymsKrt2-25
MMRRC Submission 042581-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R4987 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101431490-101438804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101487009 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 402 (I402T)
Ref Sequence ENSEMBL: ENSMUSP00000023718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023718]
Predicted Effect probably benign
Transcript: ENSMUST00000023718
AA Change: I402T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023718
Gene: ENSMUSG00000067613
AA Change: I402T

DomainStartEndE-ValueType
Pfam:Keratin_2_head 2 100 5.9e-16 PFAM
Filament 103 414 7.02e-149 SMART
low complexity region 422 436 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230173
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.3%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T C 9: 92,354,584 S175P probably damaging Het
Acrbp T C 6: 125,053,762 S249P probably benign Het
Adcy4 A G 14: 55,773,477 V661A probably benign Het
Ahdc1 T G 4: 133,064,320 H957Q possibly damaging Het
Atp10b A G 11: 43,151,613 probably benign Het
B3gnt5 A T 16: 19,769,202 N57I probably damaging Het
BC067074 T C 13: 113,318,101 V227A probably benign Het
Brms1l T A 12: 55,866,015 D264E probably benign Het
Camk1g T A 1: 193,348,475 N309Y probably damaging Het
Chl1 A G 6: 103,674,977 T285A probably damaging Het
Dennd1c G T 17: 57,073,852 T200K probably damaging Het
Dpysl3 C A 18: 43,328,427 M566I probably benign Het
Dscam A T 16: 96,697,521 D985E probably benign Het
Fmo5 T C 3: 97,635,578 M68T probably benign Het
Gm26996 A G 6: 130,590,996 unknown Het
Gm9991 A T 1: 90,675,416 noncoding transcript Het
Gzmc T A 14: 56,231,540 I241L probably damaging Het
Hibadh A T 6: 52,622,895 S105R probably damaging Het
Krtap31-2 A G 11: 99,936,570 D76G possibly damaging Het
Lin9 A G 1: 180,668,764 S249G probably damaging Het
Lpcat1 T A 13: 73,489,103 probably null Het
Mfap4 A G 11: 61,486,082 I46V probably benign Het
Nos1 T C 5: 117,926,533 probably null Het
Nostrin A G 2: 69,156,431 M107V probably benign Het
Nutm2 C T 13: 50,472,343 T322I possibly damaging Het
Olfr1080 A C 2: 86,553,235 D296E probably null Het
Pcdha12 T A 18: 37,021,551 V441E probably damaging Het
Plcd4 A G 1: 74,547,959 probably benign Het
Ppme1 T C 7: 100,345,071 D145G probably benign Het
Rbm25 T C 12: 83,677,856 V793A probably damaging Het
Rlbp1 A T 7: 79,380,131 V118E probably damaging Het
Serinc2 C T 4: 130,263,027 probably null Het
Slc25a32 A G 15: 39,100,019 C136R possibly damaging Het
Smco2 A G 6: 146,856,092 D48G possibly damaging Het
Trpv4 T C 5: 114,622,732 D846G probably benign Het
Ubr1 A T 2: 120,963,566 L46I probably benign Het
Wdsub1 A G 2: 59,870,393 probably benign Het
Zp3 T A 5: 135,987,505 C320* probably null Het
Other mutations in Krt83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Krt83 APN 15 101488211 missense probably benign 0.17
IGL01315:Krt83 APN 15 101486967 splice site probably benign
IGL01702:Krt83 APN 15 101491218 missense probably benign 0.18
IGL02123:Krt83 APN 15 101487585 missense possibly damaging 0.49
IGL02353:Krt83 APN 15 101485458 missense probably benign
IGL02360:Krt83 APN 15 101485458 missense probably benign
IGL02395:Krt83 APN 15 101487952 missense probably benign 0.18
IGL02633:Krt83 APN 15 101491214 missense probably damaging 1.00
R0357:Krt83 UTSW 15 101487019 missense probably benign 0.17
R0650:Krt83 UTSW 15 101487040 missense probably damaging 0.99
R0928:Krt83 UTSW 15 101491280 missense probably benign 0.00
R1126:Krt83 UTSW 15 101487482 missense probably damaging 0.98
R1196:Krt83 UTSW 15 101491433 missense probably benign 0.03
R1252:Krt83 UTSW 15 101487830 missense probably damaging 1.00
R1513:Krt83 UTSW 15 101489657 missense probably benign 0.30
R1612:Krt83 UTSW 15 101488211 missense probably benign 0.17
R1870:Krt83 UTSW 15 101487190 missense probably benign
R2173:Krt83 UTSW 15 101487937 missense probably damaging 0.98
R2432:Krt83 UTSW 15 101488156 nonsense probably null
R2568:Krt83 UTSW 15 101487827 missense possibly damaging 0.67
R2696:Krt83 UTSW 15 101487009 missense probably benign 0.01
R3508:Krt83 UTSW 15 101488158 missense probably benign 0.04
R4364:Krt83 UTSW 15 101487514 missense probably benign
R4366:Krt83 UTSW 15 101487514 missense probably benign
R4606:Krt83 UTSW 15 101487049 missense probably benign 0.18
R4721:Krt83 UTSW 15 101487982 missense probably damaging 1.00
R4784:Krt83 UTSW 15 101487956 missense probably damaging 1.00
R5008:Krt83 UTSW 15 101491224 missense probably damaging 1.00
R5101:Krt83 UTSW 15 101487510 missense probably benign 0.14
R5367:Krt83 UTSW 15 101486994 missense probably damaging 1.00
R5516:Krt83 UTSW 15 101487121 nonsense probably null
R5949:Krt83 UTSW 15 101487595 missense probably damaging 0.99
R5972:Krt83 UTSW 15 101487586 missense probably benign
R6036:Krt83 UTSW 15 101487531 missense possibly damaging 0.78
R6036:Krt83 UTSW 15 101487531 missense possibly damaging 0.78
R6135:Krt83 UTSW 15 101487534 missense probably damaging 1.00
R7151:Krt83 UTSW 15 101489648 missense probably damaging 1.00
R7186:Krt83 UTSW 15 101487202 splice site probably null
R7297:Krt83 UTSW 15 101489647 missense probably benign 0.42
R7708:Krt83 UTSW 15 101487932 missense probably benign 0.00
R7796:Krt83 UTSW 15 101485984 missense possibly damaging 0.95
R8172:Krt83 UTSW 15 101485403 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TAGCGACAATGGCTTGTGTG -3'
(R):5'- TTCCCAGAACACCAAGCTGG -3'

Sequencing Primer
(F):5'- GTGTTAAGTCCACTTAAGGCCAG -3'
(R):5'- GAGGCTGCTGTGACCCAATC -3'
Posted On2016-05-10