Mutagenetix > Incidental Mutation

Incidental Mutation 'R4988:St8sia4'

385935

Institutional Source

Beutler Lab

Gene Symbol

St8sia4

Ensembl Gene

ENSMUSG00000040710

Gene Name

ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4

Synonyms

ST8SiaIV, PST, Siat8d, PST-1

MMRRC Submission

042582-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4988 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95587682-95667571 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 95591797 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 322 (Y322F)

Ref Sequence

ENSEMBL: ENSMUSP00000043477 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043336]

AlphaFold

Q64692

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043336
AA Change: Y322F

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000043477
Gene: ENSMUSG00000040710
AA Change: Y322F

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Glyco_transf_29	94	354	2.2e-73	PFAM

Meta Mutation Damage Score

0.0801

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.7%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the polycondensation of alpha-2,8-linked sialic acid required for the synthesis of polysialic acid, a modulator of the adhesive properties of neural cell adhesion molecule (NCAM1). The encoded protein, which is a member of glycosyltransferase family 29, is a type II membrane protein that may be present in the Golgi apparatus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null adult mice exhibit impaired long term potentiation and impaired long term depression in hippocampal CA1 synapses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA986860	G	A	1: 130,742,710	G223E	probably damaging	Het
Abcb11	T	C	2: 69,323,892	N110S	probably benign	Het
Acaca	T	A	11: 84,263,295	H947Q	probably damaging	Het
Akap13	T	C	7: 75,730,528	M2202T	probably damaging	Het
Amy2b	T	C	3: 113,151,234		noncoding transcript	Het
Arhgef4	A	T	1: 34,723,454	H597L	unknown	Het
Asgr2	A	G	11: 70,097,839	I119M	probably benign	Het
Casc3	T	G	11: 98,821,874		probably null	Het
Ccdc7b	T	A	8: 129,145,532	M239K	possibly damaging	Het
Cdc27	A	G	11: 104,526,124	S334P	possibly damaging	Het
Ces1c	T	C	8: 93,100,708	E476G	probably damaging	Het
Clec3a	T	A	8: 114,418,087	M1K	probably null	Het
Col9a1	T	C	1: 24,185,192	S152P	unknown	Het
Cpd	A	G	11: 76,814,830	S359P	probably damaging	Het
Ctnnal1	A	T	4: 56,847,854	L95*	probably null	Het
Dhx57	T	C	17: 80,251,398	D1044G	probably damaging	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Efcab5	A	G	11: 77,137,252	S418P	probably damaging	Het
Elp5	T	C	11: 69,979,842	D59G	probably benign	Het
Fam210a	G	A	18: 68,276,147	R31C	probably benign	Het
Farp1	A	G	14: 121,275,607	T792A	probably damaging	Het
Fmc1	A	T	6: 38,534,982	Y37F	probably benign	Het
Gm10717	T	A	9: 3,026,368	L72M	probably benign	Het
Gm1758	A	T	16: 14,502,203		noncoding transcript	Het
Gm4553	G	A	7: 142,164,992		probably benign	Het
Gm5678	A	G	16: 93,629,996	T162A	probably benign	Het
Gpr156	A	G	16: 37,948,215	T33A	possibly damaging	Het
H2-Ke6	A	G	17: 34,027,288	F137S	probably damaging	Het
Hhat	A	T	1: 192,657,294		probably benign	Het
Hint2	T	C	4: 43,654,953	I59V	possibly damaging	Het
Hps4	C	T	5: 112,378,153		probably benign	Het
Klrc2	A	T	6: 129,656,463	C192S	probably benign	Het
Map1a	C	T	2: 121,303,050	T1211I	probably benign	Het
Mtus1	T	C	8: 41,084,541	N46S	probably benign	Het
Myo18a	T	C	11: 77,845,521		probably null	Het
Nbas	T	C	12: 13,408,265	S1258P	probably benign	Het
Ndst1	C	T	18: 60,702,933	G426D	probably damaging	Het
Nepro	A	G	16: 44,734,542	E327G	possibly damaging	Het
Nutm2	C	T	13: 50,472,343	T322I	possibly damaging	Het
Olfr165	A	T	16: 19,407,110	M302K	probably benign	Het
Olfr347	T	C	2: 36,734,984	I221T	possibly damaging	Het
Olfr798	T	C	10: 129,626,061		probably null	Het
Olfr982	G	A	9: 40,074,665	M123I	probably damaging	Het
Pcdhb15	G	A	18: 37,475,802	A696T	probably damaging	Het
Polm	C	A	11: 5,837,618	R45L	probably damaging	Het
Pon3	G	A	6: 5,254,582	R27*	probably null	Het
Proser1	T	C	3: 53,479,625	I845T	probably damaging	Het
Rassf8	A	G	6: 145,817,144	N406D	possibly damaging	Het
Skint10	A	T	4: 112,728,872	C182*	probably null	Het
Slc6a19	C	T	13: 73,685,840	W366*	probably null	Het
St7	T	C	6: 17,934,226	F470L	probably damaging	Het
Trav8-2	A	T	14: 53,738,357		probably benign	Het
Vwa8	A	T	14: 79,198,283	H1811L	probably benign	Het
Zfp14	G	A	7: 30,038,057	T501I	probably benign	Het

Other mutations in St8sia4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01566:St8sia4	APN	1	95653757	missense	probably benign	0.19
IGL02109:St8sia4	APN	1	95660892	missense	possibly damaging	0.68
IGL03117:St8sia4	APN	1	95591783	missense	probably benign	0.12
IGL03280:St8sia4	APN	1	95653774	splice site	probably benign
IGL03328:St8sia4	APN	1	95660870	missense	probably benign	0.01
R0336:St8sia4	UTSW	1	95653558	missense	probably benign	0.36
R0433:St8sia4	UTSW	1	95591704	missense	probably damaging	0.97
R1217:St8sia4	UTSW	1	95653739	missense	probably damaging	1.00
R1721:St8sia4	UTSW	1	95653669	missense	probably damaging	0.99
R1752:St8sia4	UTSW	1	95591812	missense	probably benign	0.32
R1891:St8sia4	UTSW	1	95591708	missense	possibly damaging	0.93
R1909:St8sia4	UTSW	1	95627573	missense	probably damaging	1.00
R2098:St8sia4	UTSW	1	95653528	missense	probably damaging	1.00
R2322:St8sia4	UTSW	1	95653738	missense	probably damaging	1.00
R4094:St8sia4	UTSW	1	95627686	missense	possibly damaging	0.53
R4365:St8sia4	UTSW	1	95591792	missense	possibly damaging	0.89
R4852:St8sia4	UTSW	1	95660898	missense	probably damaging	1.00
R5074:St8sia4	UTSW	1	95667185	missense	probably benign	0.29
R5220:St8sia4	UTSW	1	95627735	missense	probably damaging	0.97
R5611:St8sia4	UTSW	1	95627684	missense	probably damaging	0.96
R5970:St8sia4	UTSW	1	95653582	missense	probably damaging	1.00
R6027:St8sia4	UTSW	1	95653674	missense	probably damaging	1.00
R6683:St8sia4	UTSW	1	95653699	missense	probably damaging	1.00
R7498:St8sia4	UTSW	1	95591693	missense	probably benign
R7937:St8sia4	UTSW	1	95653595	missense	possibly damaging	0.56
R8775:St8sia4	UTSW	1	95591747	missense	possibly damaging	0.93
R8775-TAIL:St8sia4	UTSW	1	95591747	missense	possibly damaging	0.93
R9095:St8sia4	UTSW	1	95591800	missense	probably damaging	0.99
R9252:St8sia4	UTSW	1	95627507	frame shift	probably null
R9433:St8sia4	UTSW	1	95627639	missense
X0063:St8sia4	UTSW	1	95591923	missense	possibly damaging	0.92
Z1177:St8sia4	UTSW	1	95667456	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- TCAAGTGGTGGATGCTGAATC -3'
(R):5'- CTTCTAGATACTGGCTGACTAACAAAG -3'

Sequencing Primer
(F):5'- GATCCTGATTCTAAATCTCCAGAAGC -3'
(R):5'- CTGGCTGACTAACAAAGTTCCTATC -3'

Posted On

2016-05-10