Incidental Mutation 'R4988:AA986860'
ID 385936
Institutional Source Beutler Lab
Gene Symbol AA986860
Ensembl Gene ENSMUSG00000042510
Gene Name expressed sequence AA986860
Synonyms
MMRRC Submission 042582-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R4988 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 130659713-130672359 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 130670447 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 223 (G223E)
Ref Sequence ENSEMBL: ENSMUSP00000046172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039323]
AlphaFold Q8BI29
Predicted Effect probably damaging
Transcript: ENSMUST00000039323
AA Change: G223E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046172
Gene: ENSMUSG00000042510
AA Change: G223E

DomainStartEndE-ValueType
Pfam:SARG 33 606 1e-235 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190859
Meta Mutation Damage Score 0.1247 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,154,236 (GRCm39) N110S probably benign Het
Acaca T A 11: 84,154,121 (GRCm39) H947Q probably damaging Het
Akap13 T C 7: 75,380,276 (GRCm39) M2202T probably damaging Het
Amy2b T C 3: 113,058,550 (GRCm39) noncoding transcript Het
Arhgef4 A T 1: 34,762,535 (GRCm39) H597L unknown Het
Asgr2 A G 11: 69,988,665 (GRCm39) I119M probably benign Het
Casc3 T G 11: 98,712,700 (GRCm39) probably null Het
Cbr1b A G 16: 93,426,884 (GRCm39) T162A probably benign Het
Ccdc7b T A 8: 129,872,013 (GRCm39) M239K possibly damaging Het
Cdc27 A G 11: 104,416,950 (GRCm39) S334P possibly damaging Het
Ces1c T C 8: 93,827,336 (GRCm39) E476G probably damaging Het
Clec3a T A 8: 115,144,827 (GRCm39) M1K probably null Het
Col9a1 T C 1: 24,224,273 (GRCm39) S152P unknown Het
Cpd A G 11: 76,705,656 (GRCm39) S359P probably damaging Het
Ctnnal1 A T 4: 56,847,854 (GRCm39) L95* probably null Het
Dhx57 T C 17: 80,558,827 (GRCm39) D1044G probably damaging Het
Dync1h1 C A 12: 110,624,560 (GRCm39) T3700N probably damaging Het
Efcab5 A G 11: 77,028,078 (GRCm39) S418P probably damaging Het
Elp5 T C 11: 69,870,668 (GRCm39) D59G probably benign Het
Fam210a G A 18: 68,409,218 (GRCm39) R31C probably benign Het
Farp1 A G 14: 121,513,019 (GRCm39) T792A probably damaging Het
Fmc1 A T 6: 38,511,917 (GRCm39) Y37F probably benign Het
Gm10717 T A 9: 3,026,368 (GRCm39) L72M probably benign Het
Gm1758 A T 16: 14,320,067 (GRCm39) noncoding transcript Het
Gm4553 G A 7: 141,718,729 (GRCm39) probably benign Het
Gpr156 A G 16: 37,768,577 (GRCm39) T33A possibly damaging Het
Hhat A T 1: 192,339,602 (GRCm39) probably benign Het
Hint2 T C 4: 43,654,953 (GRCm39) I59V possibly damaging Het
Hps4 C T 5: 112,526,019 (GRCm39) probably benign Het
Hsd17b8 A G 17: 34,246,262 (GRCm39) F137S probably damaging Het
Klrc2 A T 6: 129,633,426 (GRCm39) C192S probably benign Het
Map1a C T 2: 121,133,531 (GRCm39) T1211I probably benign Het
Mtus1 T C 8: 41,537,578 (GRCm39) N46S probably benign Het
Myo18a T C 11: 77,736,347 (GRCm39) probably null Het
Nbas T C 12: 13,458,266 (GRCm39) S1258P probably benign Het
Ndst1 C T 18: 60,836,005 (GRCm39) G426D probably damaging Het
Nepro A G 16: 44,554,905 (GRCm39) E327G possibly damaging Het
Nutm2 C T 13: 50,626,379 (GRCm39) T322I possibly damaging Het
Or10s1 G A 9: 39,985,961 (GRCm39) M123I probably damaging Het
Or1j18 T C 2: 36,624,996 (GRCm39) I221T possibly damaging Het
Or2m13 A T 16: 19,225,860 (GRCm39) M302K probably benign Het
Or6c66 T C 10: 129,461,930 (GRCm39) probably null Het
Pcdhb15 G A 18: 37,608,855 (GRCm39) A696T probably damaging Het
Polm C A 11: 5,787,618 (GRCm39) R45L probably damaging Het
Pon3 G A 6: 5,254,582 (GRCm39) R27* probably null Het
Proser1 T C 3: 53,387,046 (GRCm39) I845T probably damaging Het
Rassf8 A G 6: 145,762,870 (GRCm39) N406D possibly damaging Het
Skint10 A T 4: 112,586,069 (GRCm39) C182* probably null Het
Slc6a19 C T 13: 73,833,959 (GRCm39) W366* probably null Het
St7 T C 6: 17,934,225 (GRCm39) F470L probably damaging Het
St8sia4 T A 1: 95,519,522 (GRCm39) Y322F possibly damaging Het
Trav8n-2 A T 14: 53,975,814 (GRCm39) probably benign Het
Vwa8 A T 14: 79,435,723 (GRCm39) H1811L probably benign Het
Zfp14 G A 7: 29,737,482 (GRCm39) T501I probably benign Het
Other mutations in AA986860
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:AA986860 APN 1 130,670,573 (GRCm39) missense possibly damaging 0.69
IGL01761:AA986860 APN 1 130,670,459 (GRCm39) missense possibly damaging 0.70
IGL02557:AA986860 APN 1 130,670,444 (GRCm39) missense probably benign 0.02
IGL03003:AA986860 APN 1 130,671,509 (GRCm39) missense probably damaging 1.00
IGL02802:AA986860 UTSW 1 130,671,130 (GRCm39) missense probably benign 0.00
R0326:AA986860 UTSW 1 130,670,635 (GRCm39) missense possibly damaging 0.87
R0483:AA986860 UTSW 1 130,671,562 (GRCm39) missense probably damaging 1.00
R0906:AA986860 UTSW 1 130,665,430 (GRCm39) splice site probably benign
R0932:AA986860 UTSW 1 130,665,430 (GRCm39) splice site probably null
R1522:AA986860 UTSW 1 130,670,831 (GRCm39) missense probably damaging 1.00
R1762:AA986860 UTSW 1 130,665,425 (GRCm39) critical splice donor site probably null
R1874:AA986860 UTSW 1 130,670,428 (GRCm39) missense probably benign 0.06
R2083:AA986860 UTSW 1 130,668,806 (GRCm39) missense probably damaging 1.00
R2091:AA986860 UTSW 1 130,670,906 (GRCm39) missense probably benign 0.01
R2093:AA986860 UTSW 1 130,671,041 (GRCm39) missense probably benign 0.13
R3546:AA986860 UTSW 1 130,668,926 (GRCm39) splice site probably benign
R3915:AA986860 UTSW 1 130,670,344 (GRCm39) missense probably benign
R4679:AA986860 UTSW 1 130,670,140 (GRCm39) missense possibly damaging 0.67
R4703:AA986860 UTSW 1 130,671,092 (GRCm39) missense probably benign 0.19
R4890:AA986860 UTSW 1 130,668,725 (GRCm39) splice site probably benign
R5171:AA986860 UTSW 1 130,670,584 (GRCm39) missense probably benign 0.23
R5327:AA986860 UTSW 1 130,668,740 (GRCm39) missense probably damaging 1.00
R5424:AA986860 UTSW 1 130,670,678 (GRCm39) missense probably damaging 1.00
R5763:AA986860 UTSW 1 130,670,768 (GRCm39) missense possibly damaging 0.53
R5799:AA986860 UTSW 1 130,668,908 (GRCm39) nonsense probably null
R6247:AA986860 UTSW 1 130,670,780 (GRCm39) missense possibly damaging 0.78
R7124:AA986860 UTSW 1 130,670,624 (GRCm39) missense possibly damaging 0.67
R7747:AA986860 UTSW 1 130,671,284 (GRCm39) missense possibly damaging 0.60
Z1176:AA986860 UTSW 1 130,670,728 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TAACAGCCCCGTCTCTGAAG -3'
(R):5'- CTGAAGGTAGAGAAAGTTCTTCAGC -3'

Sequencing Primer
(F):5'- CGTCTCTGAAGCATCTGAGG -3'
(R):5'- AAAGTTCTTCAGCTTTCGTGGGC -3'
Posted On 2016-05-10