Incidental Mutation 'R4988:Hhat'
ID385937
Institutional Source Beutler Lab
Gene Symbol Hhat
Ensembl Gene ENSMUSG00000037375
Gene Namehedgehog acyltransferase
Synonyms2810432O22Rik, Skn, AP-2CRE, Tg(TFAP2A-cre)1Will
MMRRC Submission 042582-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4988 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location192496711-192771223 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 192657294 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044190] [ENSMUST00000128619] [ENSMUST00000192585]
Predicted Effect probably benign
Transcript: ENSMUST00000044190
SMART Domains Protein: ENSMUSP00000046686
Gene: ENSMUSG00000037375

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
transmembrane domain 71 88 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
Pfam:MBOAT 125 448 5.7e-51 PFAM
transmembrane domain 466 488 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123721
Predicted Effect probably benign
Transcript: ENSMUST00000128619
SMART Domains Protein: ENSMUSP00000120479
Gene: ENSMUSG00000037375

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
transmembrane domain 71 88 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
Pfam:MBOAT 125 448 3.1e-60 PFAM
transmembrane domain 475 497 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154755
Predicted Effect probably benign
Transcript: ENSMUST00000192585
SMART Domains Protein: ENSMUSP00000141575
Gene: ENSMUSG00000037375

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
transmembrane domain 71 88 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
Pfam:MBOAT 125 448 2.4e-51 PFAM
transmembrane domain 475 497 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] 'Skinny hedgehog' (SKI1) encodes an enzyme that acts within the secretory pathway to catalyze amino-terminal palmitoylation of 'hedgehog' (see MIM 600725).[supplied by OMIM, Jul 2002]
PHENOTYPE: Homozygous null mice display neonatal lethality, holoprosencephaly, short-limb dwarfism, and oligodactyly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 G A 1: 130,742,710 G223E probably damaging Het
Abcb11 T C 2: 69,323,892 N110S probably benign Het
Acaca T A 11: 84,263,295 H947Q probably damaging Het
Akap13 T C 7: 75,730,528 M2202T probably damaging Het
Amy2b T C 3: 113,151,234 noncoding transcript Het
Arhgef4 A T 1: 34,723,454 H597L unknown Het
Asgr2 A G 11: 70,097,839 I119M probably benign Het
Casc3 T G 11: 98,821,874 probably null Het
Ccdc7b T A 8: 129,145,532 M239K possibly damaging Het
Cdc27 A G 11: 104,526,124 S334P possibly damaging Het
Ces1c T C 8: 93,100,708 E476G probably damaging Het
Clec3a T A 8: 114,418,087 M1K probably null Het
Col9a1 T C 1: 24,185,192 S152P unknown Het
Cpd A G 11: 76,814,830 S359P probably damaging Het
Ctnnal1 A T 4: 56,847,854 L95* probably null Het
Dhx57 T C 17: 80,251,398 D1044G probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Efcab5 A G 11: 77,137,252 S418P probably damaging Het
Elp5 T C 11: 69,979,842 D59G probably benign Het
Fam210a G A 18: 68,276,147 R31C probably benign Het
Farp1 A G 14: 121,275,607 T792A probably damaging Het
Fmc1 A T 6: 38,534,982 Y37F probably benign Het
Gm10717 T A 9: 3,026,368 L72M probably benign Het
Gm1758 A T 16: 14,502,203 noncoding transcript Het
Gm4553 G A 7: 142,164,992 probably benign Het
Gm5678 A G 16: 93,629,996 T162A probably benign Het
Gpr156 A G 16: 37,948,215 T33A possibly damaging Het
H2-Ke6 A G 17: 34,027,288 F137S probably damaging Het
Hint2 T C 4: 43,654,953 I59V possibly damaging Het
Hps4 C T 5: 112,378,153 probably benign Het
Klrc2 A T 6: 129,656,463 C192S probably benign Het
Map1a C T 2: 121,303,050 T1211I probably benign Het
Mtus1 T C 8: 41,084,541 N46S probably benign Het
Myo18a T C 11: 77,845,521 probably null Het
Nbas T C 12: 13,408,265 S1258P probably benign Het
Ndst1 C T 18: 60,702,933 G426D probably damaging Het
Nepro A G 16: 44,734,542 E327G possibly damaging Het
Nutm2 C T 13: 50,472,343 T322I possibly damaging Het
Olfr165 A T 16: 19,407,110 M302K probably benign Het
Olfr347 T C 2: 36,734,984 I221T possibly damaging Het
Olfr798 T C 10: 129,626,061 probably null Het
Olfr982 G A 9: 40,074,665 M123I probably damaging Het
Pcdhb15 G A 18: 37,475,802 A696T probably damaging Het
Polm C A 11: 5,837,618 R45L probably damaging Het
Pon3 G A 6: 5,254,582 R27* probably null Het
Proser1 T C 3: 53,479,625 I845T probably damaging Het
Rassf8 A G 6: 145,817,144 N406D possibly damaging Het
Skint10 A T 4: 112,728,872 C182* probably null Het
Slc6a19 C T 13: 73,685,840 W366* probably null Het
St7 T C 6: 17,934,226 F470L probably damaging Het
St8sia4 T A 1: 95,591,797 Y322F possibly damaging Het
Trav8-2 A T 14: 53,738,357 probably benign Het
Vwa8 A T 14: 79,198,283 H1811L probably benign Het
Zfp14 G A 7: 30,038,057 T501I probably benign Het
Other mutations in Hhat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Hhat APN 1 192717017 missense probably damaging 1.00
IGL02578:Hhat APN 1 192693913 missense probably damaging 0.98
R0420:Hhat UTSW 1 192552934 splice site probably null
R0842:Hhat UTSW 1 192726331 missense probably benign 0.07
R1794:Hhat UTSW 1 192693906 nonsense probably null
R1978:Hhat UTSW 1 192717107 missense probably benign 0.03
R2073:Hhat UTSW 1 192727379 missense possibly damaging 0.94
R2571:Hhat UTSW 1 192553022 missense probably damaging 1.00
R2891:Hhat UTSW 1 192595086 missense probably damaging 1.00
R4685:Hhat UTSW 1 192595054 missense probably damaging 1.00
R4781:Hhat UTSW 1 192686979 intron probably benign
R5002:Hhat UTSW 1 192543190 missense probably benign 0.23
R5018:Hhat UTSW 1 192595038 missense probably damaging 1.00
R5023:Hhat UTSW 1 192727339 missense probably damaging 1.00
R5695:Hhat UTSW 1 192717019 missense probably damaging 0.99
R6151:Hhat UTSW 1 192759757 missense probably damaging 1.00
R6239:Hhat UTSW 1 192595087 missense probably damaging 1.00
R7007:Hhat UTSW 1 192693826 missense possibly damaging 0.51
R7079:Hhat UTSW 1 192553046 missense possibly damaging 0.95
R7534:Hhat UTSW 1 192726304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCAAGATATCCTCTTCATGACC -3'
(R):5'- ATGATGACTGCGGGATAGC -3'

Sequencing Primer
(F):5'- GCCTGGTCTACAAAGAGAGTTCC -3'
(R):5'- TGCGGGATAGCAATGAGC -3'
Posted On2016-05-10