Incidental Mutation 'R4988:Abcb11'
ID 385939
Institutional Source Beutler Lab
Gene Symbol Abcb11
Ensembl Gene ENSMUSG00000027048
Gene Name ATP-binding cassette, sub-family B member 11
Synonyms sister of P-glycoprotein, ABC16, PFIC2, Bsep, PGY4, Lith1
MMRRC Submission 042582-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.732) question?
Stock # R4988 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 69068626-69172960 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 69154236 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 110 (N110S)
Ref Sequence ENSEMBL: ENSMUSP00000137017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]
AlphaFold Q9QY30
Predicted Effect probably benign
Transcript: ENSMUST00000102709
AA Change: N110S

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: N110S

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 373 1.3e-65 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1031 2.7e-55 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102710
AA Change: N110S

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: N110S

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.7e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 3.2e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180142
AA Change: N110S

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: N110S

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.4e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 2.5e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Meta Mutation Damage Score 0.1560 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 G A 1: 130,670,447 (GRCm39) G223E probably damaging Het
Acaca T A 11: 84,154,121 (GRCm39) H947Q probably damaging Het
Akap13 T C 7: 75,380,276 (GRCm39) M2202T probably damaging Het
Amy2b T C 3: 113,058,550 (GRCm39) noncoding transcript Het
Arhgef4 A T 1: 34,762,535 (GRCm39) H597L unknown Het
Asgr2 A G 11: 69,988,665 (GRCm39) I119M probably benign Het
Casc3 T G 11: 98,712,700 (GRCm39) probably null Het
Cbr1b A G 16: 93,426,884 (GRCm39) T162A probably benign Het
Ccdc7b T A 8: 129,872,013 (GRCm39) M239K possibly damaging Het
Cdc27 A G 11: 104,416,950 (GRCm39) S334P possibly damaging Het
Ces1c T C 8: 93,827,336 (GRCm39) E476G probably damaging Het
Clec3a T A 8: 115,144,827 (GRCm39) M1K probably null Het
Col9a1 T C 1: 24,224,273 (GRCm39) S152P unknown Het
Cpd A G 11: 76,705,656 (GRCm39) S359P probably damaging Het
Ctnnal1 A T 4: 56,847,854 (GRCm39) L95* probably null Het
Dhx57 T C 17: 80,558,827 (GRCm39) D1044G probably damaging Het
Dync1h1 C A 12: 110,624,560 (GRCm39) T3700N probably damaging Het
Efcab5 A G 11: 77,028,078 (GRCm39) S418P probably damaging Het
Elp5 T C 11: 69,870,668 (GRCm39) D59G probably benign Het
Fam210a G A 18: 68,409,218 (GRCm39) R31C probably benign Het
Farp1 A G 14: 121,513,019 (GRCm39) T792A probably damaging Het
Fmc1 A T 6: 38,511,917 (GRCm39) Y37F probably benign Het
Gm10717 T A 9: 3,026,368 (GRCm39) L72M probably benign Het
Gm1758 A T 16: 14,320,067 (GRCm39) noncoding transcript Het
Gm4553 G A 7: 141,718,729 (GRCm39) probably benign Het
Gpr156 A G 16: 37,768,577 (GRCm39) T33A possibly damaging Het
Hhat A T 1: 192,339,602 (GRCm39) probably benign Het
Hint2 T C 4: 43,654,953 (GRCm39) I59V possibly damaging Het
Hps4 C T 5: 112,526,019 (GRCm39) probably benign Het
Hsd17b8 A G 17: 34,246,262 (GRCm39) F137S probably damaging Het
Klrc2 A T 6: 129,633,426 (GRCm39) C192S probably benign Het
Map1a C T 2: 121,133,531 (GRCm39) T1211I probably benign Het
Mtus1 T C 8: 41,537,578 (GRCm39) N46S probably benign Het
Myo18a T C 11: 77,736,347 (GRCm39) probably null Het
Nbas T C 12: 13,458,266 (GRCm39) S1258P probably benign Het
Ndst1 C T 18: 60,836,005 (GRCm39) G426D probably damaging Het
Nepro A G 16: 44,554,905 (GRCm39) E327G possibly damaging Het
Nutm2 C T 13: 50,626,379 (GRCm39) T322I possibly damaging Het
Or10s1 G A 9: 39,985,961 (GRCm39) M123I probably damaging Het
Or1j18 T C 2: 36,624,996 (GRCm39) I221T possibly damaging Het
Or2m13 A T 16: 19,225,860 (GRCm39) M302K probably benign Het
Or6c66 T C 10: 129,461,930 (GRCm39) probably null Het
Pcdhb15 G A 18: 37,608,855 (GRCm39) A696T probably damaging Het
Polm C A 11: 5,787,618 (GRCm39) R45L probably damaging Het
Pon3 G A 6: 5,254,582 (GRCm39) R27* probably null Het
Proser1 T C 3: 53,387,046 (GRCm39) I845T probably damaging Het
Rassf8 A G 6: 145,762,870 (GRCm39) N406D possibly damaging Het
Skint10 A T 4: 112,586,069 (GRCm39) C182* probably null Het
Slc6a19 C T 13: 73,833,959 (GRCm39) W366* probably null Het
St7 T C 6: 17,934,225 (GRCm39) F470L probably damaging Het
St8sia4 T A 1: 95,519,522 (GRCm39) Y322F possibly damaging Het
Trav8n-2 A T 14: 53,975,814 (GRCm39) probably benign Het
Vwa8 A T 14: 79,435,723 (GRCm39) H1811L probably benign Het
Zfp14 G A 7: 29,737,482 (GRCm39) T501I probably benign Het
Other mutations in Abcb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Abcb11 APN 2 69,115,025 (GRCm39) missense possibly damaging 0.90
IGL01407:Abcb11 APN 2 69,076,288 (GRCm39) missense probably damaging 1.00
IGL01583:Abcb11 APN 2 69,126,753 (GRCm39) missense possibly damaging 0.81
IGL01813:Abcb11 APN 2 69,117,936 (GRCm39) splice site probably benign
IGL01885:Abcb11 APN 2 69,117,971 (GRCm39) missense probably damaging 1.00
IGL01937:Abcb11 APN 2 69,117,956 (GRCm39) missense probably damaging 1.00
IGL02058:Abcb11 APN 2 69,073,842 (GRCm39) missense probably damaging 0.98
IGL02117:Abcb11 APN 2 69,154,169 (GRCm39) splice site probably benign
IGL02119:Abcb11 APN 2 69,158,344 (GRCm39) critical splice acceptor site probably null
IGL02120:Abcb11 APN 2 69,087,654 (GRCm39) missense probably damaging 1.00
IGL02158:Abcb11 APN 2 69,130,269 (GRCm39) missense probably damaging 0.96
IGL02212:Abcb11 APN 2 69,079,233 (GRCm39) missense probably damaging 0.97
IGL02306:Abcb11 APN 2 69,095,801 (GRCm39) nonsense probably null
IGL02505:Abcb11 APN 2 69,076,105 (GRCm39) missense probably damaging 1.00
IGL02538:Abcb11 APN 2 69,136,949 (GRCm39) missense possibly damaging 0.67
IGL02793:Abcb11 APN 2 69,122,293 (GRCm39) missense possibly damaging 0.90
IGL02863:Abcb11 APN 2 69,115,026 (GRCm39) missense probably damaging 0.99
IGL02875:Abcb11 APN 2 69,122,293 (GRCm39) missense possibly damaging 0.90
IGL03164:Abcb11 APN 2 69,122,343 (GRCm39) nonsense probably null
IGL03181:Abcb11 APN 2 69,158,352 (GRCm39) intron probably benign
3-1:Abcb11 UTSW 2 69,158,337 (GRCm39) missense probably benign 0.00
FR4737:Abcb11 UTSW 2 69,073,862 (GRCm39) missense probably damaging 0.97
R0031:Abcb11 UTSW 2 69,115,652 (GRCm39) missense probably damaging 1.00
R0398:Abcb11 UTSW 2 69,117,010 (GRCm39) missense probably null 0.82
R0413:Abcb11 UTSW 2 69,158,355 (GRCm39) intron probably benign
R0437:Abcb11 UTSW 2 69,087,639 (GRCm39) missense probably damaging 1.00
R0496:Abcb11 UTSW 2 69,108,228 (GRCm39) splice site probably benign
R0646:Abcb11 UTSW 2 69,115,627 (GRCm39) missense probably damaging 1.00
R0669:Abcb11 UTSW 2 69,159,662 (GRCm39) missense probably benign 0.15
R0856:Abcb11 UTSW 2 69,154,262 (GRCm39) missense probably benign
R1061:Abcb11 UTSW 2 69,108,153 (GRCm39) missense probably benign 0.00
R1460:Abcb11 UTSW 2 69,087,718 (GRCm39) splice site probably benign
R1714:Abcb11 UTSW 2 69,136,925 (GRCm39) missense probably damaging 0.99
R1739:Abcb11 UTSW 2 69,091,910 (GRCm39) missense probably damaging 1.00
R1856:Abcb11 UTSW 2 69,076,267 (GRCm39) missense probably damaging 1.00
R1994:Abcb11 UTSW 2 69,113,014 (GRCm39) splice site probably null
R2086:Abcb11 UTSW 2 69,089,820 (GRCm39) splice site probably benign
R2133:Abcb11 UTSW 2 69,154,227 (GRCm39) missense possibly damaging 0.65
R2516:Abcb11 UTSW 2 69,159,673 (GRCm39) missense possibly damaging 0.88
R2930:Abcb11 UTSW 2 69,087,702 (GRCm39) missense probably damaging 0.96
R3771:Abcb11 UTSW 2 69,159,720 (GRCm39) splice site probably benign
R3772:Abcb11 UTSW 2 69,159,720 (GRCm39) splice site probably benign
R3979:Abcb11 UTSW 2 69,154,320 (GRCm39) missense probably benign 0.11
R4227:Abcb11 UTSW 2 69,115,120 (GRCm39) missense probably damaging 1.00
R4255:Abcb11 UTSW 2 69,136,949 (GRCm39) missense probably benign 0.03
R4614:Abcb11 UTSW 2 69,115,025 (GRCm39) missense possibly damaging 0.90
R4647:Abcb11 UTSW 2 69,115,615 (GRCm39) missense probably damaging 1.00
R4719:Abcb11 UTSW 2 69,089,971 (GRCm39) missense probably damaging 1.00
R4734:Abcb11 UTSW 2 69,154,306 (GRCm39) missense possibly damaging 0.73
R4765:Abcb11 UTSW 2 69,076,211 (GRCm39) missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69,076,249 (GRCm39) missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69,076,249 (GRCm39) missense probably damaging 1.00
R4870:Abcb11 UTSW 2 69,069,540 (GRCm39) missense probably damaging 0.99
R5028:Abcb11 UTSW 2 69,104,356 (GRCm39) missense probably damaging 1.00
R5048:Abcb11 UTSW 2 69,138,850 (GRCm39) missense probably benign 0.06
R5177:Abcb11 UTSW 2 69,115,639 (GRCm39) missense probably damaging 1.00
R5301:Abcb11 UTSW 2 69,117,191 (GRCm39) missense probably damaging 0.98
R5789:Abcb11 UTSW 2 69,076,108 (GRCm39) missense probably damaging 1.00
R5892:Abcb11 UTSW 2 69,091,844 (GRCm39) missense probably damaging 0.99
R6003:Abcb11 UTSW 2 69,073,811 (GRCm39) missense probably benign 0.43
R6252:Abcb11 UTSW 2 69,122,305 (GRCm39) missense probably benign 0.10
R6389:Abcb11 UTSW 2 69,154,238 (GRCm39) missense probably damaging 1.00
R6512:Abcb11 UTSW 2 69,112,996 (GRCm39) missense probably benign
R6590:Abcb11 UTSW 2 69,115,062 (GRCm39) missense probably damaging 1.00
R6690:Abcb11 UTSW 2 69,115,062 (GRCm39) missense probably damaging 1.00
R6732:Abcb11 UTSW 2 69,117,190 (GRCm39) missense probably damaging 1.00
R6870:Abcb11 UTSW 2 69,115,642 (GRCm39) missense possibly damaging 0.91
R7028:Abcb11 UTSW 2 69,096,019 (GRCm39) missense probably benign
R7223:Abcb11 UTSW 2 69,104,487 (GRCm39) missense probably benign
R7323:Abcb11 UTSW 2 69,117,979 (GRCm39) missense probably damaging 1.00
R7337:Abcb11 UTSW 2 69,076,113 (GRCm39) missense probably damaging 1.00
R7339:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7340:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7341:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7343:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7366:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7393:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7394:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7405:Abcb11 UTSW 2 69,117,963 (GRCm39) missense probably damaging 1.00
R7411:Abcb11 UTSW 2 69,134,280 (GRCm39) critical splice donor site probably null
R7488:Abcb11 UTSW 2 69,108,146 (GRCm39) missense probably benign
R7544:Abcb11 UTSW 2 69,095,830 (GRCm39) missense probably benign 0.05
R7660:Abcb11 UTSW 2 69,117,938 (GRCm39) splice site probably null
R7754:Abcb11 UTSW 2 69,117,162 (GRCm39) missense probably damaging 1.00
R7771:Abcb11 UTSW 2 69,069,535 (GRCm39) missense probably damaging 0.99
R7794:Abcb11 UTSW 2 69,117,022 (GRCm39) missense possibly damaging 0.62
R7834:Abcb11 UTSW 2 69,115,068 (GRCm39) missense probably damaging 1.00
R7897:Abcb11 UTSW 2 69,154,217 (GRCm39) small deletion probably benign
R7897:Abcb11 UTSW 2 69,154,216 (GRCm39) frame shift probably null
R7937:Abcb11 UTSW 2 69,154,217 (GRCm39) small deletion probably benign
R8004:Abcb11 UTSW 2 69,087,554 (GRCm39) missense possibly damaging 0.68
R8089:Abcb11 UTSW 2 69,104,383 (GRCm39) missense probably benign 0.09
R8279:Abcb11 UTSW 2 69,069,549 (GRCm39) missense probably benign 0.05
R8426:Abcb11 UTSW 2 69,155,606 (GRCm39) missense probably benign
R8441:Abcb11 UTSW 2 69,087,574 (GRCm39) missense possibly damaging 0.93
R8460:Abcb11 UTSW 2 69,154,381 (GRCm39) missense possibly damaging 0.70
R8462:Abcb11 UTSW 2 69,104,499 (GRCm39) missense probably benign
R8532:Abcb11 UTSW 2 69,090,035 (GRCm39) missense possibly damaging 0.69
R8534:Abcb11 UTSW 2 69,154,190 (GRCm39) missense possibly damaging 0.89
R8711:Abcb11 UTSW 2 69,095,856 (GRCm39) missense probably damaging 1.00
R8746:Abcb11 UTSW 2 69,087,754 (GRCm39) intron probably benign
R8964:Abcb11 UTSW 2 69,117,061 (GRCm39) missense possibly damaging 0.52
R8990:Abcb11 UTSW 2 69,104,494 (GRCm39) missense
R9081:Abcb11 UTSW 2 69,122,388 (GRCm39) missense possibly damaging 0.59
R9093:Abcb11 UTSW 2 69,069,513 (GRCm39) missense probably damaging 0.97
R9228:Abcb11 UTSW 2 69,138,809 (GRCm39) nonsense probably null
R9294:Abcb11 UTSW 2 69,095,840 (GRCm39) missense possibly damaging 0.89
X0058:Abcb11 UTSW 2 69,119,787 (GRCm39) missense probably benign 0.12
X0062:Abcb11 UTSW 2 69,076,250 (GRCm39) missense probably damaging 1.00
X0065:Abcb11 UTSW 2 69,130,210 (GRCm39) missense probably damaging 0.99
Z1176:Abcb11 UTSW 2 69,122,325 (GRCm39) missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69,159,613 (GRCm39) critical splice donor site probably null
Z1177:Abcb11 UTSW 2 69,136,873 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGCTTTGAAACCTGGAAGG -3'
(R):5'- TCTTCATCAAAAGACAACTGGC -3'

Sequencing Primer
(F):5'- CCTGGAAGGATGGAAATAGCTAC -3'
(R):5'- CTTCATCAAAAGACAACTGGCTGATG -3'
Posted On 2016-05-10