Incidental Mutation 'R4988:Olfr982'
ID385957
Institutional Source Beutler Lab
Gene Symbol Olfr982
Ensembl Gene ENSMUSG00000049010
Gene Nameolfactory receptor 982
SynonymsMOR223-4, GA_x6K02T2PVTD-33772307-33773260
MMRRC Submission 042582-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R4988 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location40073829-40079404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40074665 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 123 (M123I)
Ref Sequence ENSEMBL: ENSMUSP00000052705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054051]
Predicted Effect probably damaging
Transcript: ENSMUST00000054051
AA Change: M123I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052705
Gene: ENSMUSG00000049010
AA Change: M123I

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 4.2e-48 PFAM
Pfam:7tm_1 45 293 6.7e-24 PFAM
low complexity region 314 321 N/A INTRINSIC
Meta Mutation Damage Score 0.2288 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 G A 1: 130,742,710 G223E probably damaging Het
Abcb11 T C 2: 69,323,892 N110S probably benign Het
Acaca T A 11: 84,263,295 H947Q probably damaging Het
Akap13 T C 7: 75,730,528 M2202T probably damaging Het
Amy2b T C 3: 113,151,234 noncoding transcript Het
Arhgef4 A T 1: 34,723,454 H597L unknown Het
Asgr2 A G 11: 70,097,839 I119M probably benign Het
Casc3 T G 11: 98,821,874 probably null Het
Ccdc7b T A 8: 129,145,532 M239K possibly damaging Het
Cdc27 A G 11: 104,526,124 S334P possibly damaging Het
Ces1c T C 8: 93,100,708 E476G probably damaging Het
Clec3a T A 8: 114,418,087 M1K probably null Het
Col9a1 T C 1: 24,185,192 S152P unknown Het
Cpd A G 11: 76,814,830 S359P probably damaging Het
Ctnnal1 A T 4: 56,847,854 L95* probably null Het
Dhx57 T C 17: 80,251,398 D1044G probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Efcab5 A G 11: 77,137,252 S418P probably damaging Het
Elp5 T C 11: 69,979,842 D59G probably benign Het
Fam210a G A 18: 68,276,147 R31C probably benign Het
Farp1 A G 14: 121,275,607 T792A probably damaging Het
Fmc1 A T 6: 38,534,982 Y37F probably benign Het
Gm10717 T A 9: 3,026,368 L72M probably benign Het
Gm1758 A T 16: 14,502,203 noncoding transcript Het
Gm4553 G A 7: 142,164,992 probably benign Het
Gm5678 A G 16: 93,629,996 T162A probably benign Het
Gpr156 A G 16: 37,948,215 T33A possibly damaging Het
H2-Ke6 A G 17: 34,027,288 F137S probably damaging Het
Hhat A T 1: 192,657,294 probably benign Het
Hint2 T C 4: 43,654,953 I59V possibly damaging Het
Hps4 C T 5: 112,378,153 probably benign Het
Klrc2 A T 6: 129,656,463 C192S probably benign Het
Map1a C T 2: 121,303,050 T1211I probably benign Het
Mtus1 T C 8: 41,084,541 N46S probably benign Het
Myo18a T C 11: 77,845,521 probably null Het
Nbas T C 12: 13,408,265 S1258P probably benign Het
Ndst1 C T 18: 60,702,933 G426D probably damaging Het
Nepro A G 16: 44,734,542 E327G possibly damaging Het
Nutm2 C T 13: 50,472,343 T322I possibly damaging Het
Olfr165 A T 16: 19,407,110 M302K probably benign Het
Olfr347 T C 2: 36,734,984 I221T possibly damaging Het
Olfr798 T C 10: 129,626,061 probably null Het
Pcdhb15 G A 18: 37,475,802 A696T probably damaging Het
Polm C A 11: 5,837,618 R45L probably damaging Het
Pon3 G A 6: 5,254,582 R27* probably null Het
Proser1 T C 3: 53,479,625 I845T probably damaging Het
Rassf8 A G 6: 145,817,144 N406D possibly damaging Het
Skint10 A T 4: 112,728,872 C182* probably null Het
Slc6a19 C T 13: 73,685,840 W366* probably null Het
St7 T C 6: 17,934,226 F470L probably damaging Het
St8sia4 T A 1: 95,591,797 Y322F possibly damaging Het
Trav8-2 A T 14: 53,738,357 probably benign Het
Vwa8 A T 14: 79,198,283 H1811L probably benign Het
Zfp14 G A 7: 30,038,057 T501I probably benign Het
Other mutations in Olfr982
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Olfr982 APN 9 40074776 missense probably damaging 1.00
IGL02095:Olfr982 APN 9 40074671 nonsense probably null
IGL02160:Olfr982 APN 9 40075186 missense probably damaging 1.00
R0277:Olfr982 UTSW 9 40074714 missense probably benign 0.05
R1241:Olfr982 UTSW 9 40074896 missense probably damaging 1.00
R1344:Olfr982 UTSW 9 40074472 missense probably damaging 1.00
R1418:Olfr982 UTSW 9 40074472 missense probably damaging 1.00
R1838:Olfr982 UTSW 9 40074309 missense probably benign
R1864:Olfr982 UTSW 9 40074785 missense possibly damaging 0.88
R2165:Olfr982 UTSW 9 40074915 missense possibly damaging 0.96
R3808:Olfr982 UTSW 9 40074309 missense probably benign
R4633:Olfr982 UTSW 9 40074334 missense probably damaging 1.00
R5569:Olfr982 UTSW 9 40074297 start codon destroyed probably null 0.39
R6307:Olfr982 UTSW 9 40074528 missense probably damaging 1.00
R6594:Olfr982 UTSW 9 40074943 missense probably damaging 1.00
R6863:Olfr982 UTSW 9 40074814 missense probably damaging 1.00
R7064:Olfr982 UTSW 9 40074813 missense probably damaging 1.00
R7602:Olfr982 UTSW 9 40075159 missense probably damaging 1.00
R8460:Olfr982 UTSW 9 40075057 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGTGGCAATCTCCTCATTC -3'
(R):5'- CAATATGCTGAGGCCCACAG -3'

Sequencing Primer
(F):5'- TACTGTGGGCTCTGACCC -3'
(R):5'- TATGCTGAGGCCCACAGTACAG -3'
Posted On2016-05-10