Incidental Mutation 'R4988:Farp1'
ID385973
Institutional Source Beutler Lab
Gene Symbol Farp1
Ensembl Gene ENSMUSG00000025555
Gene NameFERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived)
SynonymsCdep
MMRRC Submission 042582-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4988 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location121035200-121283744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121275607 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 792 (T792A)
Ref Sequence ENSEMBL: ENSMUSP00000026635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026635]
Predicted Effect probably damaging
Transcript: ENSMUST00000026635
AA Change: T792A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026635
Gene: ENSMUSG00000025555
AA Change: T792A

DomainStartEndE-ValueType
B41 36 230 3.27e-68 SMART
FERM_C 234 324 3.87e-32 SMART
FA 328 374 6.07e-16 SMART
RhoGEF 546 732 2.07e-47 SMART
PH 763 861 1.05e-16 SMART
PH 936 1034 1.55e-19 SMART
Meta Mutation Damage Score 0.3296 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a FERM (4.2, exrin, radixin, moesin) domain, a Dbl homology domain, and two pleckstrin homology domains. These domains are found in guanine nucleotide exchange factors and proteins that link the cytoskeleton to the cell membrane. The encoded protein functions in neurons to promote dendritic growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 G A 1: 130,742,710 G223E probably damaging Het
Abcb11 T C 2: 69,323,892 N110S probably benign Het
Acaca T A 11: 84,263,295 H947Q probably damaging Het
Akap13 T C 7: 75,730,528 M2202T probably damaging Het
Amy2b T C 3: 113,151,234 noncoding transcript Het
Arhgef4 A T 1: 34,723,454 H597L unknown Het
Asgr2 A G 11: 70,097,839 I119M probably benign Het
Casc3 T G 11: 98,821,874 probably null Het
Ccdc7b T A 8: 129,145,532 M239K possibly damaging Het
Cdc27 A G 11: 104,526,124 S334P possibly damaging Het
Ces1c T C 8: 93,100,708 E476G probably damaging Het
Clec3a T A 8: 114,418,087 M1K probably null Het
Col9a1 T C 1: 24,185,192 S152P unknown Het
Cpd A G 11: 76,814,830 S359P probably damaging Het
Ctnnal1 A T 4: 56,847,854 L95* probably null Het
Dhx57 T C 17: 80,251,398 D1044G probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Efcab5 A G 11: 77,137,252 S418P probably damaging Het
Elp5 T C 11: 69,979,842 D59G probably benign Het
Fam210a G A 18: 68,276,147 R31C probably benign Het
Fmc1 A T 6: 38,534,982 Y37F probably benign Het
Gm10717 T A 9: 3,026,368 L72M probably benign Het
Gm1758 A T 16: 14,502,203 noncoding transcript Het
Gm4553 G A 7: 142,164,992 probably benign Het
Gm5678 A G 16: 93,629,996 T162A probably benign Het
Gpr156 A G 16: 37,948,215 T33A possibly damaging Het
H2-Ke6 A G 17: 34,027,288 F137S probably damaging Het
Hhat A T 1: 192,657,294 probably benign Het
Hint2 T C 4: 43,654,953 I59V possibly damaging Het
Hps4 C T 5: 112,378,153 probably benign Het
Klrc2 A T 6: 129,656,463 C192S probably benign Het
Map1a C T 2: 121,303,050 T1211I probably benign Het
Mtus1 T C 8: 41,084,541 N46S probably benign Het
Myo18a T C 11: 77,845,521 probably null Het
Nbas T C 12: 13,408,265 S1258P probably benign Het
Ndst1 C T 18: 60,702,933 G426D probably damaging Het
Nepro A G 16: 44,734,542 E327G possibly damaging Het
Nutm2 C T 13: 50,472,343 T322I possibly damaging Het
Olfr165 A T 16: 19,407,110 M302K probably benign Het
Olfr347 T C 2: 36,734,984 I221T possibly damaging Het
Olfr798 T C 10: 129,626,061 probably null Het
Olfr982 G A 9: 40,074,665 M123I probably damaging Het
Pcdhb15 G A 18: 37,475,802 A696T probably damaging Het
Polm C A 11: 5,837,618 R45L probably damaging Het
Pon3 G A 6: 5,254,582 R27* probably null Het
Proser1 T C 3: 53,479,625 I845T probably damaging Het
Rassf8 A G 6: 145,817,144 N406D possibly damaging Het
Skint10 A T 4: 112,728,872 C182* probably null Het
Slc6a19 C T 13: 73,685,840 W366* probably null Het
St7 T C 6: 17,934,226 F470L probably damaging Het
St8sia4 T A 1: 95,591,797 Y322F possibly damaging Het
Trav8-2 A T 14: 53,738,357 probably benign Het
Vwa8 A T 14: 79,198,283 H1811L probably benign Het
Zfp14 G A 7: 30,038,057 T501I probably benign Het
Other mutations in Farp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Farp1 APN 14 121237149 missense probably damaging 1.00
IGL01017:Farp1 APN 14 121272774 missense possibly damaging 0.64
IGL02309:Farp1 APN 14 121243516 missense probably benign
IGL02376:Farp1 APN 14 121272856 missense probably damaging 0.98
IGL03018:Farp1 APN 14 121102169 missense probably benign
IGL03400:Farp1 APN 14 121207321 missense probably damaging 1.00
R0034:Farp1 UTSW 14 121255429 missense probably benign 0.00
R0046:Farp1 UTSW 14 121255513 missense probably benign 0.00
R0046:Farp1 UTSW 14 121255513 missense probably benign 0.00
R0219:Farp1 UTSW 14 121243600 missense possibly damaging 0.88
R0359:Farp1 UTSW 14 121255396 splice site probably benign
R0616:Farp1 UTSW 14 121277022 missense probably damaging 1.00
R0653:Farp1 UTSW 14 121233846 critical splice donor site probably null
R0710:Farp1 UTSW 14 121237143 missense probably damaging 1.00
R1391:Farp1 UTSW 14 121257966 nonsense probably null
R1791:Farp1 UTSW 14 121256745 missense probably damaging 1.00
R1920:Farp1 UTSW 14 121255496 missense probably benign 0.16
R1953:Farp1 UTSW 14 121255482 missense probably benign
R1958:Farp1 UTSW 14 121219375 critical splice acceptor site probably null
R2891:Farp1 UTSW 14 121256736 missense probably damaging 1.00
R3121:Farp1 UTSW 14 121222726 splice site probably benign
R4005:Farp1 UTSW 14 121276397 missense probably damaging 0.99
R4257:Farp1 UTSW 14 121255479 missense probably benign 0.00
R4559:Farp1 UTSW 14 121272801 missense probably damaging 1.00
R4654:Farp1 UTSW 14 121276304 missense possibly damaging 0.50
R4739:Farp1 UTSW 14 121238787 missense probably damaging 1.00
R4831:Farp1 UTSW 14 121277057 missense probably damaging 1.00
R5379:Farp1 UTSW 14 121256757 missense possibly damaging 0.88
R5463:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5466:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5467:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5511:Farp1 UTSW 14 121237172 missense probably damaging 0.98
R5520:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5635:Farp1 UTSW 14 121276304 missense possibly damaging 0.96
R5639:Farp1 UTSW 14 121275382 missense probably damaging 1.00
R5954:Farp1 UTSW 14 121222667 missense probably damaging 0.99
R6765:Farp1 UTSW 14 121222654 missense probably benign 0.00
R7469:Farp1 UTSW 14 121275421 missense probably damaging 1.00
R7549:Farp1 UTSW 14 121235177 missense possibly damaging 0.89
R7660:Farp1 UTSW 14 121276922 missense probably benign 0.00
R7752:Farp1 UTSW 14 121257947 missense probably damaging 1.00
R7788:Farp1 UTSW 14 121276253 missense probably benign 0.12
R7911:Farp1 UTSW 14 121242406 missense probably damaging 1.00
R8013:Farp1 UTSW 14 121242401 missense probably damaging 1.00
R8078:Farp1 UTSW 14 121276300 missense probably benign 0.04
R8113:Farp1 UTSW 14 121275596 missense probably benign 0.35
R8116:Farp1 UTSW 14 121233820 missense probably damaging 1.00
R8716:Farp1 UTSW 14 121242443 missense probably benign
RF024:Farp1 UTSW 14 121237148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGCATGTTCTTCCTGGTG -3'
(R):5'- TACAGCCCAGGTTAACTCTCCC -3'

Sequencing Primer
(F):5'- CCTGGTGAGTGGGGCAAG -3'
(R):5'- GTTAACTCTCCCTGCATTCTACAAAG -3'
Posted On2016-05-10