Incidental Mutation 'R4988:Pcdhb15'
ID385978
Institutional Source Beutler Lab
Gene Symbol Pcdhb15
Ensembl Gene ENSMUSG00000047033
Gene Nameprotocadherin beta 15
SynonymsPcdhbO, Pcdhb7
MMRRC Submission 042582-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4988 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37473540-37476340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37475802 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 696 (A696T)
Ref Sequence ENSEMBL: ENSMUSP00000059598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050034] [ENSMUST00000051442] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000050034
AA Change: A696T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059598
Gene: ENSMUSG00000047033
AA Change: A696T

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 2.6e-33 PFAM
CA 155 240 7.79e-22 SMART
CA 264 345 4.37e-25 SMART
CA 368 449 4.4e-21 SMART
CA 473 559 7.38e-23 SMART
CA 589 670 4.48e-13 SMART
Pfam:Cadherin_C_2 686 770 5.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051442
SMART Domains Protein: ENSMUSP00000056347
Gene: ENSMUSG00000047910

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 46 132 7.7e-1 SMART
CA 156 241 1.93e-17 SMART
CA 265 346 4.2e-27 SMART
CA 369 450 1.08e-24 SMART
CA 474 560 3.31e-25 SMART
CA 590 671 2.87e-11 SMART
Pfam:Cadherin_C_2 687 770 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.3471 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. The transcript for this particular family member uses more than one polyadenylation site. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 G A 1: 130,742,710 G223E probably damaging Het
Abcb11 T C 2: 69,323,892 N110S probably benign Het
Acaca T A 11: 84,263,295 H947Q probably damaging Het
Akap13 T C 7: 75,730,528 M2202T probably damaging Het
Amy2b T C 3: 113,151,234 noncoding transcript Het
Arhgef4 A T 1: 34,723,454 H597L unknown Het
Asgr2 A G 11: 70,097,839 I119M probably benign Het
Casc3 T G 11: 98,821,874 probably null Het
Ccdc7b T A 8: 129,145,532 M239K possibly damaging Het
Cdc27 A G 11: 104,526,124 S334P possibly damaging Het
Ces1c T C 8: 93,100,708 E476G probably damaging Het
Clec3a T A 8: 114,418,087 M1K probably null Het
Col9a1 T C 1: 24,185,192 S152P unknown Het
Cpd A G 11: 76,814,830 S359P probably damaging Het
Ctnnal1 A T 4: 56,847,854 L95* probably null Het
Dhx57 T C 17: 80,251,398 D1044G probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Efcab5 A G 11: 77,137,252 S418P probably damaging Het
Elp5 T C 11: 69,979,842 D59G probably benign Het
Fam210a G A 18: 68,276,147 R31C probably benign Het
Farp1 A G 14: 121,275,607 T792A probably damaging Het
Fmc1 A T 6: 38,534,982 Y37F probably benign Het
Gm10717 T A 9: 3,026,368 L72M probably benign Het
Gm1758 A T 16: 14,502,203 noncoding transcript Het
Gm4553 G A 7: 142,164,992 probably benign Het
Gm5678 A G 16: 93,629,996 T162A probably benign Het
Gpr156 A G 16: 37,948,215 T33A possibly damaging Het
H2-Ke6 A G 17: 34,027,288 F137S probably damaging Het
Hhat A T 1: 192,657,294 probably benign Het
Hint2 T C 4: 43,654,953 I59V possibly damaging Het
Hps4 C T 5: 112,378,153 probably benign Het
Klrc2 A T 6: 129,656,463 C192S probably benign Het
Map1a C T 2: 121,303,050 T1211I probably benign Het
Mtus1 T C 8: 41,084,541 N46S probably benign Het
Myo18a T C 11: 77,845,521 probably null Het
Nbas T C 12: 13,408,265 S1258P probably benign Het
Ndst1 C T 18: 60,702,933 G426D probably damaging Het
Nepro A G 16: 44,734,542 E327G possibly damaging Het
Nutm2 C T 13: 50,472,343 T322I possibly damaging Het
Olfr165 A T 16: 19,407,110 M302K probably benign Het
Olfr347 T C 2: 36,734,984 I221T possibly damaging Het
Olfr798 T C 10: 129,626,061 probably null Het
Olfr982 G A 9: 40,074,665 M123I probably damaging Het
Polm C A 11: 5,837,618 R45L probably damaging Het
Pon3 G A 6: 5,254,582 R27* probably null Het
Proser1 T C 3: 53,479,625 I845T probably damaging Het
Rassf8 A G 6: 145,817,144 N406D possibly damaging Het
Skint10 A T 4: 112,728,872 C182* probably null Het
Slc6a19 C T 13: 73,685,840 W366* probably null Het
St7 T C 6: 17,934,226 F470L probably damaging Het
St8sia4 T A 1: 95,591,797 Y322F possibly damaging Het
Trav8-2 A T 14: 53,738,357 probably benign Het
Vwa8 A T 14: 79,198,283 H1811L probably benign Het
Zfp14 G A 7: 30,038,057 T501I probably benign Het
Other mutations in Pcdhb15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Pcdhb15 APN 18 37475154 missense probably damaging 1.00
IGL01536:Pcdhb15 APN 18 37474993 missense probably benign 0.01
IGL01664:Pcdhb15 APN 18 37474261 missense probably benign 0.35
IGL02001:Pcdhb15 APN 18 37474038 missense probably benign 0.01
IGL02161:Pcdhb15 APN 18 37475502 missense possibly damaging 0.78
IGL02205:Pcdhb15 APN 18 37473957 missense probably damaging 0.99
IGL02748:Pcdhb15 APN 18 37475220 missense probably damaging 0.98
IGL02828:Pcdhb15 APN 18 37473850 missense probably damaging 0.97
IGL02974:Pcdhb15 APN 18 37475014 missense probably damaging 1.00
IGL03119:Pcdhb15 APN 18 37475014 missense probably damaging 1.00
IGL03136:Pcdhb15 APN 18 37475014 missense probably damaging 1.00
IGL03150:Pcdhb15 APN 18 37475014 missense probably damaging 1.00
PIT1430001:Pcdhb15 UTSW 18 37475671 missense probably benign 0.15
R0266:Pcdhb15 UTSW 18 37475276 missense probably damaging 1.00
R0288:Pcdhb15 UTSW 18 37475398 missense probably damaging 1.00
R0399:Pcdhb15 UTSW 18 37474168 missense possibly damaging 0.56
R0400:Pcdhb15 UTSW 18 37475895 missense probably benign
R0554:Pcdhb15 UTSW 18 37474519 missense probably damaging 1.00
R0637:Pcdhb15 UTSW 18 37475566 missense probably damaging 1.00
R0714:Pcdhb15 UTSW 18 37474621 missense probably damaging 0.98
R1118:Pcdhb15 UTSW 18 37473762 missense probably benign 0.01
R1423:Pcdhb15 UTSW 18 37473922 missense probably damaging 0.97
R1672:Pcdhb15 UTSW 18 37474660 missense probably damaging 1.00
R1681:Pcdhb15 UTSW 18 37473813 missense probably damaging 1.00
R1779:Pcdhb15 UTSW 18 37476031 missense possibly damaging 0.95
R2206:Pcdhb15 UTSW 18 37475022 missense probably benign 0.05
R2207:Pcdhb15 UTSW 18 37475022 missense probably benign 0.05
R2274:Pcdhb15 UTSW 18 37475443 missense probably damaging 1.00
R3406:Pcdhb15 UTSW 18 37475389 missense probably benign 0.41
R3407:Pcdhb15 UTSW 18 37474389 missense possibly damaging 0.80
R3417:Pcdhb15 UTSW 18 37475163 missense probably damaging 1.00
R3752:Pcdhb15 UTSW 18 37473757 missense probably damaging 1.00
R3773:Pcdhb15 UTSW 18 37475890 missense probably benign 0.00
R4432:Pcdhb15 UTSW 18 37475512 missense probably damaging 1.00
R4433:Pcdhb15 UTSW 18 37475512 missense probably damaging 1.00
R4583:Pcdhb15 UTSW 18 37475575 missense possibly damaging 0.91
R4612:Pcdhb15 UTSW 18 37475595 missense probably damaging 0.96
R5635:Pcdhb15 UTSW 18 37473770 nonsense probably null
R5692:Pcdhb15 UTSW 18 37474449 missense probably benign 0.01
R5742:Pcdhb15 UTSW 18 37474767 missense probably damaging 0.99
R5913:Pcdhb15 UTSW 18 37474654 missense probably benign 0.07
R6350:Pcdhb15 UTSW 18 37475361 missense probably damaging 1.00
R6522:Pcdhb15 UTSW 18 37474261 missense probably benign 0.35
R6676:Pcdhb15 UTSW 18 37474807 missense possibly damaging 0.60
R6693:Pcdhb15 UTSW 18 37474341 missense probably benign 0.01
R6905:Pcdhb15 UTSW 18 37474695 missense possibly damaging 0.95
R7029:Pcdhb15 UTSW 18 37475568 missense possibly damaging 0.85
R7335:Pcdhb15 UTSW 18 37474336 missense probably damaging 1.00
R7529:Pcdhb15 UTSW 18 37474473 nonsense probably null
R7718:Pcdhb15 UTSW 18 37475163 missense probably damaging 1.00
X0062:Pcdhb15 UTSW 18 37476015 nonsense probably null
X0063:Pcdhb15 UTSW 18 37475084 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTACTAAGCGAGCGAGATGTGC -3'
(R):5'- ATCCCTGATCCTCCAGTCAG -3'

Sequencing Primer
(F):5'- AGCGAGATGTGCCCAAGC -3'
(R):5'- AGACACACCTCATACTGGTAGTTCTG -3'
Posted On2016-05-10