Incidental Mutation 'R4989:Hadh'
ID386012
Institutional Source Beutler Lab
Gene Symbol Hadh
Ensembl Gene ENSMUSG00000027984
Gene Namehydroxyacyl-Coenzyme A dehydrogenase
SynonymsHadhsc, Schad
MMRRC Submission 042583-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R4989 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location131233419-131272101 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 131235548 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 274 (L274*)
Ref Sequence ENSEMBL: ENSMUSP00000029610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029610]
Predicted Effect probably null
Transcript: ENSMUST00000029610
AA Change: L274*
SMART Domains Protein: ENSMUSP00000029610
Gene: ENSMUSG00000027984
AA Change: L274*

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 4 87 1.2e-7 PFAM
Pfam:3HCDH_N 29 214 1.4e-66 PFAM
Pfam:3HCDH 216 313 7e-36 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (115/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the 3-hydroxyacyl-CoA dehydrogenase gene family. The encoded protein functions in the mitochondrial matrix to catalyze the oxidation of straight-chain 3-hydroxyacyl-CoAs as part of the beta-oxidation pathway. Its enzymatic activity is highest with medium-chain-length fatty acids. Mutations in this gene cause one form of familial hyperinsulinemic hypoglycemia. The human genome contains a related pseudogene of this gene on chromosome 15. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased susceptibility to diet-induced obesity associated with impaired fatty acid oxidation, impaired fat tolerance, decreased ketone bodies, and increased glucose-stimulated insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
4931406P16Rik A C 7: 34,245,800 Y552D probably damaging Het
Acot6 A G 12: 84,109,015 K246E probably benign Het
Actl11 T A 9: 107,931,416 H979Q probably damaging Het
Adal T A 2: 121,155,549 probably benign Het
Add2 G A 6: 86,110,858 V596I probably benign Het
Adrb3 A C 8: 27,227,770 M217R probably damaging Het
Akap2 T A 4: 57,856,552 V668E probably benign Het
Ank1 T C 8: 23,141,118 probably benign Het
Ank2 A T 3: 126,963,445 N1054K possibly damaging Het
Ankib1 T C 5: 3,713,217 Y504C probably damaging Het
Ankrd29 T C 18: 12,262,185 K217R probably damaging Het
Ankrd45 T C 1: 161,155,306 V129A probably damaging Het
Aox4 A T 1: 58,236,676 D389V probably benign Het
Aph1a G T 3: 95,895,531 G148W probably damaging Het
Arhgef26 G A 3: 62,340,385 D297N possibly damaging Het
Atxn7l3b C A 10: 112,928,744 probably benign Het
Auh A G 13: 52,841,029 S167P probably damaging Het
Bach1 A T 16: 87,719,000 K143I possibly damaging Het
Bbx T A 16: 50,224,738 T487S probably damaging Het
Bche T G 3: 73,701,844 D83A probably benign Het
Bri3bp G T 5: 125,441,696 probably benign Het
Cd3d A T 9: 44,984,998 E28D probably damaging Het
Cdc42bpa A G 1: 180,137,801 T1028A probably damaging Het
Celsr2 T C 3: 108,412,629 I956V possibly damaging Het
Cep95 A T 11: 106,816,654 probably null Het
Cic G T 7: 25,287,110 G1289C probably damaging Het
Cndp1 A G 18: 84,631,900 Y223H probably damaging Het
Cops8 A G 1: 90,611,002 D51G probably damaging Het
Csgalnact1 T C 8: 68,460,971 E194G probably benign Het
Ctsm A G 13: 61,538,962 Y39H probably damaging Het
Dhrs2 T C 14: 55,237,265 V119A probably damaging Het
Drosha T A 15: 12,935,007 M1336K probably benign Het
Dsp G A 13: 38,197,702 D2808N possibly damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Epas1 A G 17: 86,809,454 N184S probably damaging Het
Erich3 C T 3: 154,748,388 T597I possibly damaging Het
F10 T C 8: 13,055,698 V421A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fcgrt C T 7: 45,101,948 G192D probably benign Het
Fras1 A G 5: 96,650,682 E1184G possibly damaging Het
Gm5155 A G 7: 17,905,218 probably null Het
Gm8989 A T 7: 106,329,457 noncoding transcript Het
Grn C A 11: 102,430,554 probably benign Het
Hus1 T C 11: 9,006,027 S169G probably damaging Het
Hydin A T 8: 110,563,922 I3338F possibly damaging Het
Ighv11-1 T G 12: 113,982,148 E28D probably benign Het
Kctd9 C T 14: 67,729,356 T106I probably damaging Het
Krit1 A T 5: 3,822,238 N421I probably damaging Het
Lamb1 A G 12: 31,326,678 D1619G probably damaging Het
Lpar6 G A 14: 73,238,707 C36Y probably damaging Het
Lrrc37a G C 11: 103,456,739 F3043L unknown Het
Lrrc46 A T 11: 97,040,939 V19D probably damaging Het
Mapkap1 G T 2: 34,581,291 S197I probably damaging Het
Mrps35 A C 6: 147,060,147 K173N possibly damaging Het
Mtf2 A G 5: 108,073,028 probably benign Het
Mum1 T C 10: 80,232,868 L282P probably benign Het
Ncf1 A C 5: 134,223,413 D261E probably damaging Het
Notch1 C T 2: 26,481,181 E298K probably damaging Het
Nrxn1 A T 17: 90,620,846 probably benign Het
Olfr110 G T 17: 37,499,126 L158F probably benign Het
Olfr1274-ps T A 2: 90,400,763 M34K probably benign Het
Olfr195 T C 16: 59,149,618 L256P probably damaging Het
Olfr46 C A 7: 140,610,391 A75E possibly damaging Het
Olfr622 A G 7: 103,640,101 F13S probably damaging Het
Otud4 G A 8: 79,655,689 V176I probably damaging Het
Papolg T C 11: 23,873,919 probably null Het
Pgk2 A G 17: 40,207,511 V342A probably damaging Het
Phf2 G A 13: 48,807,844 A790V unknown Het
Prkdc T C 16: 15,673,997 I602T possibly damaging Het
Prl3d3 T C 13: 27,159,089 I86T possibly damaging Het
Prss8 G T 7: 127,926,463 Q295K probably benign Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Qrfpr A G 3: 36,222,136 V35A probably damaging Het
Rpf1 A G 3: 146,506,538 L349S probably damaging Het
Rpl41 G T 10: 128,548,783 probably null Het
Rprd2 G C 3: 95,765,320 R924G probably benign Het
Serpini1 T A 3: 75,614,488 N95K probably benign Het
Sfxn1 A T 13: 54,088,914 T64S probably benign Het
Siae T G 9: 37,646,520 I541S possibly damaging Het
Slc25a4 T A 8: 46,207,472 K296N probably benign Het
Slc37a1 A G 17: 31,322,146 N204S probably damaging Het
Slc9c1 A G 16: 45,593,437 N976S probably benign Het
Smarcal1 T C 1: 72,632,860 S847P possibly damaging Het
Smg1 A T 7: 118,158,100 probably benign Het
Smg1 C T 7: 118,208,051 A168T probably benign Het
Sptlc1 A G 13: 53,351,656 I242T probably damaging Het
St8sia2 T C 7: 73,966,961 I89V possibly damaging Het
Supt20 A T 3: 54,695,134 probably benign Het
Tep1 T C 14: 50,839,000 D1659G probably benign Het
Tex10 C A 4: 48,458,525 probably benign Het
Thbs3 CAGAAG CAG 3: 89,223,102 probably benign Het
Tmbim6 C A 15: 99,402,069 S22* probably null Het
Tmc2 A T 2: 130,202,041 K65M possibly damaging Het
Tmod1 A G 4: 46,090,872 S142G probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trmt6 T C 2: 132,808,271 R349G possibly damaging Het
Ttn T A 2: 76,707,242 T26454S possibly damaging Het
Ttn C T 2: 76,774,778 V16555I probably benign Het
Ubr3 T C 2: 70,020,446 probably benign Het
Vmn1r17 A C 6: 57,360,475 F253V possibly damaging Het
Vmn1r201 G T 13: 22,475,452 A279S possibly damaging Het
Vmn2r17 A T 5: 109,427,873 R203S probably benign Het
Vwa5a A G 9: 38,722,630 E43G probably benign Het
Wdr86 C T 5: 24,712,845 probably null Het
Wdsub1 A T 2: 59,870,414 probably benign Het
Zcchc11 T A 4: 108,526,845 probably benign Het
Zcchc7 T C 4: 44,931,039 L76P probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp263 T C 16: 3,749,128 C148R probably damaging Het
Zfp687 A C 3: 95,010,386 F692V probably damaging Het
Other mutations in Hadh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Hadh APN 3 131249816 missense probably benign
IGL01062:Hadh APN 3 131240991 missense probably damaging 1.00
IGL01106:Hadh APN 3 131240970 missense possibly damaging 0.89
IGL02629:Hadh APN 3 131235635 missense probably damaging 1.00
IGL02717:Hadh APN 3 131249910 missense probably benign
IGL03180:Hadh APN 3 131271884 missense probably benign 0.08
IGL03240:Hadh APN 3 131248543 missense probably benign
R0081:Hadh UTSW 3 131235636 missense probably damaging 1.00
R1687:Hadh UTSW 3 131245249 missense probably benign 0.00
R2000:Hadh UTSW 3 131245239 missense probably benign 0.11
R6851:Hadh UTSW 3 131271971 missense possibly damaging 0.91
R8787:Hadh UTSW 3 131234176 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCTCTGCCACATTGGGAC -3'
(R):5'- ACATGGGCTTTTGGACATTTTC -3'

Sequencing Primer
(F):5'- TTGGAGCATCTCTAGCTATCAGAACC -3'
(R):5'- TTCTGATGTGTGTGTTATACAACC -3'
Posted On2016-05-10