Incidental Mutation 'R0423:Gfra2'
ID38602
Institutional Source Beutler Lab
Gene Symbol Gfra2
Ensembl Gene ENSMUSG00000022103
Gene Nameglial cell line derived neurotrophic factor family receptor alpha 2
SynonymsGFR alpha-2, GFR alpha 2
MMRRC Submission 038625-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R0423 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location70890120-70979838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70896081 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 117 (T117M)
Ref Sequence ENSEMBL: ENSMUSP00000022699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022699] [ENSMUST00000227697]
Predicted Effect probably damaging
Transcript: ENSMUST00000022699
AA Change: T117M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022699
Gene: ENSMUSG00000022103
AA Change: T117M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
GDNF 40 117 1.76e-15 SMART
GDNF 161 241 3.7e-23 SMART
GDNF 251 347 1.74e-28 SMART
low complexity region 381 397 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227697
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the receptor complex that transduces glial cell-derived neurotrophic factor and neurturin signals by mediating autophosphorylation and activation of the RET receptor. Mice lacking this protein are viable and fertile but display growth retardation attributed to impaired salivary and pancreatic secretion and innervation deficits in the intestinal tract. In addition, knockout mice display neural defects including a failure to initiate outgrowth of dorsal ganglion root neurons, demonstrating a requirement in neuronal differentiation of these cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous mutants have dry eyes, poor postweaning growth associated with impaired parasympathetic cholinergic innervation of lacrimal and salivary glands and of small intestine, reduced skin thickness and accelerated hair follicle regression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik T C 2: 28,466,024 probably benign Het
4930432E11Rik A T 7: 29,562,400 noncoding transcript Het
A630001G21Rik A G 1: 85,726,466 I50T probably benign Het
Abhd12 T C 2: 150,838,392 T264A possibly damaging Het
Acsm3 T C 7: 119,777,159 Y370H probably damaging Het
Ank2 G T 3: 126,929,860 Y3789* probably null Het
Anxa4 C T 6: 86,760,737 A1T probably damaging Het
Apba1 T A 19: 23,944,998 V810D probably damaging Het
Bank1 A G 3: 136,284,017 I104T possibly damaging Het
Birc6 T C 17: 74,696,297 Y4721H probably damaging Het
Bmpr2 A G 1: 59,868,510 T921A probably benign Het
Ccdc102a A C 8: 94,905,926 probably benign Het
Ccdc141 C A 2: 77,039,450 D904Y probably damaging Het
Ccdc96 A G 5: 36,485,247 K199R probably benign Het
Cdh10 G A 15: 18,986,879 V399I probably benign Het
Cenpk A G 13: 104,234,225 T85A probably benign Het
Col6a2 A C 10: 76,614,917 V60G possibly damaging Het
Cops7b A G 1: 86,599,031 D119G probably benign Het
Cstf2t A G 19: 31,084,276 E404G possibly damaging Het
Ctnna2 A T 6: 77,653,069 V134E probably damaging Het
Cwh43 A C 5: 73,416,742 M250L probably benign Het
D17Wsu92e A C 17: 27,786,233 Y117D probably damaging Het
Daam2 T A 17: 49,469,421 K813* probably null Het
Dhcr24 G A 4: 106,586,536 probably benign Het
Dnah8 G T 17: 30,701,981 R1182L probably benign Het
Doc2a C T 7: 126,848,658 P25S probably damaging Het
Dst A G 1: 34,278,035 S6823G possibly damaging Het
Espl1 T A 15: 102,303,986 L509* probably null Het
Fbxw19 C T 9: 109,486,066 V143I probably benign Het
Fbxw5 A G 2: 25,504,526 T171A possibly damaging Het
Gm454 T A 5: 138,204,141 noncoding transcript Het
Kcnq4 A G 4: 120,717,508 S120P probably damaging Het
Krt84 A T 15: 101,528,720 L336Q probably damaging Het
Lilra6 T A 7: 3,914,775 probably benign Het
Mbnl2 G A 14: 120,325,324 R29H probably damaging Het
Mcm3ap G A 10: 76,502,705 G1389D probably benign Het
Mettl13 A T 1: 162,544,385 I305N probably damaging Het
Muc6 A G 7: 141,652,283 S30P probably benign Het
Myh7 T A 14: 54,979,189 Q1237L probably benign Het
Myo9a T G 9: 59,895,336 D2035E probably damaging Het
Nat10 A G 2: 103,748,227 S211P probably damaging Het
Ntm T C 9: 29,179,099 Y108C probably damaging Het
Olfr292 T C 7: 86,695,226 Y257H possibly damaging Het
Olfr843 A T 9: 19,248,952 L149* probably null Het
Pcdhb16 A G 18: 37,480,369 D794G probably benign Het
Phlpp1 A G 1: 106,339,615 T753A probably benign Het
Pnldc1 T C 17: 12,890,076 Q511R possibly damaging Het
Ppip5k2 A G 1: 97,761,427 S38P possibly damaging Het
Pygb A G 2: 150,823,984 K593E probably benign Het
Rangap1 A T 15: 81,705,463 F564I probably damaging Het
Rictor A T 15: 6,773,900 I498F possibly damaging Het
Rnase12 A T 14: 51,057,156 V22D probably benign Het
Rpl7l1 T A 17: 46,780,398 M93L probably benign Het
Smg1 T C 7: 118,176,880 R1396G possibly damaging Het
Snx19 C A 9: 30,435,837 T692N probably damaging Het
Spag6 A G 2: 18,710,593 D61G probably benign Het
Spen T A 4: 141,479,336 N660I unknown Het
Sptan1 T G 2: 30,028,672 C2246G probably null Het
Svopl A G 6: 38,036,707 probably benign Het
Taf2 A T 15: 55,064,682 N108K probably benign Het
Thbs4 T C 13: 92,756,571 D703G probably damaging Het
Tle6 G T 10: 81,598,623 N47K possibly damaging Het
Usp48 G T 4: 137,616,411 V452L probably benign Het
Ust A T 10: 8,298,148 S198T probably damaging Het
Wnk2 T A 13: 49,095,418 M386L possibly damaging Het
Ywhaq T C 12: 21,391,381 probably benign Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp316 A G 5: 143,253,238 S1009P probably damaging Het
Zfp963 A G 8: 69,744,506 Y29H probably damaging Het
Zmym4 A G 4: 126,882,319 probably benign Het
Zranb3 A G 1: 128,091,870 I45T probably damaging Het
Other mutations in Gfra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Gfra2 APN 14 70968239 splice site probably benign
IGL01303:Gfra2 APN 14 70895852 missense probably benign 0.09
IGL01380:Gfra2 APN 14 70967146 splice site probably benign
IGL01528:Gfra2 APN 14 70966298 missense possibly damaging 0.95
IGL02203:Gfra2 APN 14 70967084 missense possibly damaging 0.69
IGL02270:Gfra2 APN 14 70925907 missense possibly damaging 0.78
IGL03104:Gfra2 APN 14 70968285 missense probably benign 0.00
IGL03270:Gfra2 APN 14 70925904 missense possibly damaging 0.80
H8562:Gfra2 UTSW 14 70978378 missense possibly damaging 0.94
H8786:Gfra2 UTSW 14 70978378 missense possibly damaging 0.94
R4120:Gfra2 UTSW 14 70966275 missense probably damaging 1.00
R4172:Gfra2 UTSW 14 70896081 missense possibly damaging 0.80
R4712:Gfra2 UTSW 14 70925937 missense probably damaging 1.00
R4804:Gfra2 UTSW 14 70925921 missense possibly damaging 0.76
R4902:Gfra2 UTSW 14 70967015 missense probably damaging 1.00
R5424:Gfra2 UTSW 14 70895847 missense probably damaging 1.00
R6711:Gfra2 UTSW 14 70966275 missense probably damaging 1.00
R7290:Gfra2 UTSW 14 70925940 missense probably damaging 1.00
R7322:Gfra2 UTSW 14 70968391 missense probably benign 0.00
R7814:Gfra2 UTSW 14 70895970 missense probably damaging 1.00
Z1177:Gfra2 UTSW 14 70978492 missense not run
Predicted Primers PCR Primer
(F):5'- TGTGTGCGGCTGAATCCAACTG -3'
(R):5'- GAAGTCTCTGCAATCTCAAGCCCC -3'

Sequencing Primer
(F):5'- GTACCGCACCCTTCGGC -3'
(R):5'- CTTCAAGAGAGCTTGCCTAGAGTC -3'
Posted On2013-05-23