Incidental Mutation 'R4989:Smg1'
ID386040
Institutional Source Beutler Lab
Gene Symbol Smg1
Ensembl Gene ENSMUSG00000030655
Gene NameSMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Synonyms2610207I05Rik, 5430435M13Rik, C130002K18Rik
MMRRC Submission 042583-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4989 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location118131308-118243670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 118208051 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 168 (A168T)
Ref Sequence ENSEMBL: ENSMUSP00000137172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032891] [ENSMUST00000179047]
Predicted Effect unknown
Transcript: ENSMUST00000032891
AA Change: A192T
SMART Domains Protein: ENSMUSP00000032891
Gene: ENSMUSG00000030655
AA Change: A192T

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
SCOP:d1gw5a_ 147 621 7e-7 SMART
Pfam:SMG1 629 1240 9.8e-249 PFAM
low complexity region 1540 1551 N/A INTRINSIC
SCOP:d1gw5a_ 1680 1942 8e-3 SMART
low complexity region 2125 2141 N/A INTRINSIC
PI3Kc 2149 2493 7.93e-50 SMART
low complexity region 2759 2770 N/A INTRINSIC
low complexity region 3425 3442 N/A INTRINSIC
FATC 3626 3658 8.66e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179047
AA Change: A168T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137172
Gene: ENSMUSG00000030655
AA Change: A168T

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
SCOP:d1gw5a_ 123 282 7e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179331
SMART Domains Protein: ENSMUSP00000137592
Gene: ENSMUSG00000030655

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
SCOP:d1gw5a_ 71 545 1e-6 SMART
low complexity region 602 612 N/A INTRINSIC
low complexity region 631 646 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
low complexity region 898 915 N/A INTRINSIC
low complexity region 1135 1147 N/A INTRINSIC
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 2049 2065 N/A INTRINSIC
PI3Kc 2073 2417 7.93e-50 SMART
low complexity region 2683 2694 N/A INTRINSIC
low complexity region 3349 3366 N/A INTRINSIC
FATC 3550 3582 8.66e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208209
Meta Mutation Damage Score 0.0789 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (115/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in nonsense-mediated mRNA decay (NMD) as part of the mRNA surveillance complex. The protein has kinase activity and is thought to function in NMD by phosphorylating the regulator of nonsense transcripts 1 protein. Alternatively spliced transcript variants have been described, but their full-length nature has yet to be determined. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early embryonic lethality. Mice heteroygous for a gene trap allele exhibit abnormal tooth development, chronic inflammation, increased body weight, increased incidence of tumor formation and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4931406P16Rik A C 7: 34,245,800 Y552D probably damaging Het
Acot6 A G 12: 84,109,015 K246E probably benign Het
Actl11 T A 9: 107,931,416 H979Q probably damaging Het
Adal T A 2: 121,155,549 probably benign Het
Add2 G A 6: 86,110,858 V596I probably benign Het
Adrb3 A C 8: 27,227,770 M217R probably damaging Het
Akap2 T A 4: 57,856,552 V668E probably benign Het
Ank1 T C 8: 23,141,118 probably benign Het
Ank2 A T 3: 126,963,445 N1054K possibly damaging Het
Ankib1 T C 5: 3,713,217 Y504C probably damaging Het
Ankrd29 T C 18: 12,262,185 K217R probably damaging Het
Ankrd45 T C 1: 161,155,306 V129A probably damaging Het
Aox4 A T 1: 58,236,676 D389V probably benign Het
Aph1a G T 3: 95,895,531 G148W probably damaging Het
Arhgef26 G A 3: 62,340,385 D297N possibly damaging Het
Atxn7l3b C A 10: 112,928,744 probably benign Het
Auh A G 13: 52,841,029 S167P probably damaging Het
Bach1 A T 16: 87,719,000 K143I possibly damaging Het
Bbx T A 16: 50,224,738 T487S probably damaging Het
Bche T G 3: 73,701,844 D83A probably benign Het
Bri3bp G T 5: 125,441,696 probably benign Het
Cd3d A T 9: 44,984,998 E28D probably damaging Het
Cdc42bpa A G 1: 180,137,801 T1028A probably damaging Het
Celsr2 T C 3: 108,412,629 I956V possibly damaging Het
Cep95 A T 11: 106,816,654 probably null Het
Cic G T 7: 25,287,110 G1289C probably damaging Het
Cndp1 A G 18: 84,631,900 Y223H probably damaging Het
Cops8 A G 1: 90,611,002 D51G probably damaging Het
Csgalnact1 T C 8: 68,460,971 E194G probably benign Het
Ctsm A G 13: 61,538,962 Y39H probably damaging Het
Dhrs2 T C 14: 55,237,265 V119A probably damaging Het
Drosha T A 15: 12,935,007 M1336K probably benign Het
Dsp G A 13: 38,197,702 D2808N possibly damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Epas1 A G 17: 86,809,454 N184S probably damaging Het
Erich3 C T 3: 154,748,388 T597I possibly damaging Het
F10 T C 8: 13,055,698 V421A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fcgrt C T 7: 45,101,948 G192D probably benign Het
Fras1 A G 5: 96,650,682 E1184G possibly damaging Het
Gm5155 A G 7: 17,905,218 probably null Het
Gm8989 A T 7: 106,329,457 noncoding transcript Het
Grn C A 11: 102,430,554 probably benign Het
Hadh A T 3: 131,235,548 L274* probably null Het
Hus1 T C 11: 9,006,027 S169G probably damaging Het
Hydin A T 8: 110,563,922 I3338F possibly damaging Het
Ighv11-1 T G 12: 113,982,148 E28D probably benign Het
Kctd9 C T 14: 67,729,356 T106I probably damaging Het
Krit1 A T 5: 3,822,238 N421I probably damaging Het
Lamb1 A G 12: 31,326,678 D1619G probably damaging Het
Lpar6 G A 14: 73,238,707 C36Y probably damaging Het
Lrrc37a G C 11: 103,456,739 F3043L unknown Het
Lrrc46 A T 11: 97,040,939 V19D probably damaging Het
Mapkap1 G T 2: 34,581,291 S197I probably damaging Het
Mrps35 A C 6: 147,060,147 K173N possibly damaging Het
Mtf2 A G 5: 108,073,028 probably benign Het
Mum1 T C 10: 80,232,868 L282P probably benign Het
Ncf1 A C 5: 134,223,413 D261E probably damaging Het
Notch1 C T 2: 26,481,181 E298K probably damaging Het
Nrxn1 A T 17: 90,620,846 probably benign Het
Olfr110 G T 17: 37,499,126 L158F probably benign Het
Olfr1274-ps T A 2: 90,400,763 M34K probably benign Het
Olfr195 T C 16: 59,149,618 L256P probably damaging Het
Olfr46 C A 7: 140,610,391 A75E possibly damaging Het
Olfr622 A G 7: 103,640,101 F13S probably damaging Het
Otud4 G A 8: 79,655,689 V176I probably damaging Het
Papolg T C 11: 23,873,919 probably null Het
Pgk2 A G 17: 40,207,511 V342A probably damaging Het
Phf2 G A 13: 48,807,844 A790V unknown Het
Prkdc T C 16: 15,673,997 I602T possibly damaging Het
Prl3d3 T C 13: 27,159,089 I86T possibly damaging Het
Prss8 G T 7: 127,926,463 Q295K probably benign Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Qrfpr A G 3: 36,222,136 V35A probably damaging Het
Rpf1 A G 3: 146,506,538 L349S probably damaging Het
Rpl41 G T 10: 128,548,783 probably null Het
Rprd2 G C 3: 95,765,320 R924G probably benign Het
Serpini1 T A 3: 75,614,488 N95K probably benign Het
Sfxn1 A T 13: 54,088,914 T64S probably benign Het
Siae T G 9: 37,646,520 I541S possibly damaging Het
Slc25a4 T A 8: 46,207,472 K296N probably benign Het
Slc37a1 A G 17: 31,322,146 N204S probably damaging Het
Slc9c1 A G 16: 45,593,437 N976S probably benign Het
Smarcal1 T C 1: 72,632,860 S847P possibly damaging Het
Sptlc1 A G 13: 53,351,656 I242T probably damaging Het
St8sia2 T C 7: 73,966,961 I89V possibly damaging Het
Supt20 A T 3: 54,695,134 probably benign Het
Tep1 T C 14: 50,839,000 D1659G probably benign Het
Tex10 C A 4: 48,458,525 probably benign Het
Thbs3 CAGAAG CAG 3: 89,223,102 probably benign Het
Tmbim6 C A 15: 99,402,069 S22* probably null Het
Tmc2 A T 2: 130,202,041 K65M possibly damaging Het
Tmod1 A G 4: 46,090,872 S142G probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trmt6 T C 2: 132,808,271 R349G possibly damaging Het
Ttn T A 2: 76,707,242 T26454S possibly damaging Het
Ttn C T 2: 76,774,778 V16555I probably benign Het
Ubr3 T C 2: 70,020,446 probably benign Het
Vmn1r17 A C 6: 57,360,475 F253V possibly damaging Het
Vmn1r201 G T 13: 22,475,452 A279S possibly damaging Het
Vmn2r17 A T 5: 109,427,873 R203S probably benign Het
Vwa5a A G 9: 38,722,630 E43G probably benign Het
Wdr86 C T 5: 24,712,845 probably null Het
Wdsub1 A T 2: 59,870,414 probably benign Het
Zcchc11 T A 4: 108,526,845 probably benign Het
Zcchc7 T C 4: 44,931,039 L76P probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp263 T C 16: 3,749,128 C148R probably damaging Het
Zfp687 A C 3: 95,010,386 F692V probably damaging Het
Other mutations in Smg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Smg1 APN 7 118198271 utr 3 prime probably benign
IGL00481:Smg1 APN 7 118210794 missense possibly damaging 0.67
IGL00503:Smg1 APN 7 118185483 utr 3 prime probably benign
IGL00927:Smg1 APN 7 118140632 missense probably damaging 1.00
IGL01333:Smg1 APN 7 118163378 splice site probably benign
IGL01344:Smg1 APN 7 118190836 utr 3 prime probably benign
IGL01397:Smg1 APN 7 118163221 utr 3 prime probably benign
IGL01403:Smg1 APN 7 118158132 utr 3 prime probably benign
IGL01573:Smg1 APN 7 118167962 utr 3 prime probably benign
IGL01872:Smg1 APN 7 118148944 utr 3 prime probably benign
IGL02010:Smg1 APN 7 118186146 utr 3 prime probably benign
IGL02158:Smg1 APN 7 118212946 missense possibly damaging 0.77
IGL02268:Smg1 APN 7 118182541 missense probably benign 0.19
IGL02314:Smg1 APN 7 118154709 utr 3 prime probably benign
IGL02552:Smg1 APN 7 118195894 utr 3 prime probably benign
IGL02577:Smg1 APN 7 118203122 missense probably damaging 0.99
IGL02859:Smg1 APN 7 118148933 utr 3 prime probably benign
IGL02890:Smg1 APN 7 118185501 utr 3 prime probably benign
IGL02892:Smg1 APN 7 118167955 utr 3 prime probably benign
IGL03119:Smg1 APN 7 118195113 utr 3 prime probably benign
IGL03123:Smg1 APN 7 118157181 utr 3 prime probably benign
IGL03128:Smg1 APN 7 118203059 missense probably benign 0.03
IGL03184:Smg1 APN 7 118180380 missense possibly damaging 0.86
PIT4508001:Smg1 UTSW 7 118185541 missense unknown
R0010:Smg1 UTSW 7 118171859 utr 3 prime probably benign
R0010:Smg1 UTSW 7 118171859 utr 3 prime probably benign
R0025:Smg1 UTSW 7 118212443 missense possibly damaging 0.92
R0025:Smg1 UTSW 7 118212443 missense possibly damaging 0.92
R0098:Smg1 UTSW 7 118145467 missense probably benign 0.02
R0139:Smg1 UTSW 7 118152675 critical splice donor site probably null
R0371:Smg1 UTSW 7 118168300 utr 3 prime probably benign
R0415:Smg1 UTSW 7 118182468 missense probably benign 0.34
R0416:Smg1 UTSW 7 118184461 splice site probably benign
R0423:Smg1 UTSW 7 118176880 missense possibly damaging 0.53
R0600:Smg1 UTSW 7 118160383 utr 3 prime probably benign
R0626:Smg1 UTSW 7 118182383 missense possibly damaging 0.82
R0627:Smg1 UTSW 7 118167861 utr 3 prime probably benign
R0727:Smg1 UTSW 7 118166422 utr 3 prime probably benign
R0729:Smg1 UTSW 7 118146289 utr 3 prime probably benign
R0841:Smg1 UTSW 7 118143301 missense possibly damaging 0.96
R1114:Smg1 UTSW 7 118159790 utr 3 prime probably benign
R1256:Smg1 UTSW 7 118203087 missense probably damaging 1.00
R1298:Smg1 UTSW 7 118168211 utr 3 prime probably benign
R1370:Smg1 UTSW 7 118159752 utr 3 prime probably benign
R1591:Smg1 UTSW 7 118156919 utr 3 prime probably benign
R1736:Smg1 UTSW 7 118165967 splice site probably null
R1755:Smg1 UTSW 7 118203064 nonsense probably null
R1765:Smg1 UTSW 7 118139715 missense probably benign 0.03
R1789:Smg1 UTSW 7 118145798 missense possibly damaging 0.73
R1845:Smg1 UTSW 7 118154622 utr 3 prime probably benign
R1908:Smg1 UTSW 7 118154199 utr 3 prime probably benign
R1909:Smg1 UTSW 7 118154199 utr 3 prime probably benign
R1942:Smg1 UTSW 7 118158103 utr 3 prime probably benign
R2064:Smg1 UTSW 7 118156867 utr 3 prime probably benign
R2072:Smg1 UTSW 7 118163166 utr 3 prime probably benign
R2154:Smg1 UTSW 7 118158076 utr 3 prime probably benign
R2895:Smg1 UTSW 7 118189143 utr 3 prime probably benign
R2915:Smg1 UTSW 7 118210879 splice site probably benign
R3416:Smg1 UTSW 7 118148853 utr 3 prime probably benign
R3417:Smg1 UTSW 7 118148853 utr 3 prime probably benign
R3873:Smg1 UTSW 7 118154662 utr 3 prime probably benign
R4082:Smg1 UTSW 7 118160246 utr 3 prime probably benign
R4230:Smg1 UTSW 7 118148733 critical splice donor site probably null
R4304:Smg1 UTSW 7 118139518 missense probably benign 0.03
R4549:Smg1 UTSW 7 118159683 utr 3 prime probably benign
R4571:Smg1 UTSW 7 118139465 missense possibly damaging 0.72
R4638:Smg1 UTSW 7 118195926 utr 3 prime probably benign
R4642:Smg1 UTSW 7 118154264 utr 3 prime probably benign
R4656:Smg1 UTSW 7 118212951 missense probably benign 0.00
R4754:Smg1 UTSW 7 118156731 utr 3 prime probably benign
R4798:Smg1 UTSW 7 118180474 missense probably benign 0.32
R4906:Smg1 UTSW 7 118152408 utr 3 prime probably benign
R4978:Smg1 UTSW 7 118154247 utr 3 prime probably benign
R4989:Smg1 UTSW 7 118158100 utr 3 prime probably benign
R5026:Smg1 UTSW 7 118193545 utr 3 prime probably benign
R5124:Smg1 UTSW 7 118213012 missense probably benign 0.00
R5318:Smg1 UTSW 7 118160204 utr 3 prime probably benign
R5356:Smg1 UTSW 7 118195133 utr 3 prime probably benign
R5404:Smg1 UTSW 7 118206908 missense probably damaging 1.00
R5423:Smg1 UTSW 7 118146071 missense possibly damaging 0.70
R5441:Smg1 UTSW 7 118195081 utr 3 prime probably benign
R5490:Smg1 UTSW 7 118139436 missense possibly damaging 0.86
R5541:Smg1 UTSW 7 118157163 utr 3 prime probably benign
R5564:Smg1 UTSW 7 118189819 utr 3 prime probably benign
R5580:Smg1 UTSW 7 118148902 utr 3 prime probably benign
R5600:Smg1 UTSW 7 118167884 utr 3 prime probably benign
R5628:Smg1 UTSW 7 118154701 utr 3 prime probably benign
R5646:Smg1 UTSW 7 118212559 missense probably benign 0.42
R5656:Smg1 UTSW 7 118154664 utr 3 prime probably benign
R5660:Smg1 UTSW 7 118143347 missense probably benign 0.33
R5706:Smg1 UTSW 7 118145590 missense possibly damaging 0.86
R5786:Smg1 UTSW 7 118212897 missense probably benign 0.12
R5890:Smg1 UTSW 7 118190586 utr 3 prime probably benign
R5912:Smg1 UTSW 7 118154586 utr 3 prime probably benign
R5977:Smg1 UTSW 7 118141357 utr 3 prime probably benign
R5993:Smg1 UTSW 7 118140509 missense probably benign 0.33
R6161:Smg1 UTSW 7 118163330 utr 3 prime probably benign
R6187:Smg1 UTSW 7 118189163 utr 3 prime probably benign
R6264:Smg1 UTSW 7 118166087 utr 3 prime probably benign
R6331:Smg1 UTSW 7 118154277 utr 3 prime probably benign
R6561:Smg1 UTSW 7 118166077 utr 3 prime probably benign
R6571:Smg1 UTSW 7 118184514 utr 3 prime probably benign
R6736:Smg1 UTSW 7 118157166 utr 3 prime probably benign
R6752:Smg1 UTSW 7 118163316 utr 3 prime probably benign
R6777:Smg1 UTSW 7 118189117 utr 3 prime probably benign
R6788:Smg1 UTSW 7 118184571 utr 3 prime probably benign
R6883:Smg1 UTSW 7 118168180 utr 3 prime probably benign
R6991:Smg1 UTSW 7 118167868 utr 3 prime probably benign
R7056:Smg1 UTSW 7 118146400 splice site probably benign
R7058:Smg1 UTSW 7 118198279 utr 3 prime probably benign
R7100:Smg1 UTSW 7 118184520 missense unknown
R7133:Smg1 UTSW 7 118152908 missense unknown
R7221:Smg1 UTSW 7 118182797 missense possibly damaging 0.86
R7229:Smg1 UTSW 7 118176955 missense probably benign 0.03
R7293:Smg1 UTSW 7 118166099 missense unknown
R7361:Smg1 UTSW 7 118184977 missense unknown
R7438:Smg1 UTSW 7 118195893 missense unknown
R7686:Smg1 UTSW 7 118167858 missense unknown
Z1088:Smg1 UTSW 7 118154635 utr 3 prime probably benign
Z1088:Smg1 UTSW 7 118168661 nonsense probably null
Z1088:Smg1 UTSW 7 118178399 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTAGGAGACAAGAGCCTCTTTTG -3'
(R):5'- CCTAAACATTGGCTTCTGGAAAGG -3'

Sequencing Primer
(F):5'- CAAGAGCCTCTTTTGAGTAGATTCC -3'
(R):5'- GAGCTGATGCGCTATGAATG -3'
Posted On2016-05-10