Incidental Mutation 'R4989:Lrrc37a'
ID386061
Institutional Source Beutler Lab
Gene Symbol Lrrc37a
Ensembl Gene ENSMUSG00000078632
Gene Nameleucine rich repeat containing 37A
SynonymsLOC237954
MMRRC Submission 042583-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R4989 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location103451955-103504597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 103456739 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 3043 (F3043L)
Ref Sequence ENSEMBL: ENSMUSP00000121903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153273]
Predicted Effect unknown
Transcript: ENSMUST00000153273
AA Change: F3043L
SMART Domains Protein: ENSMUSP00000121903
Gene: ENSMUSG00000078632
AA Change: F3043L

DomainStartEndE-ValueType
Pfam:LRRC37 199 269 2.6e-15 PFAM
low complexity region 313 329 N/A INTRINSIC
Pfam:LRRC37 363 432 4e-18 PFAM
low complexity region 457 467 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
Pfam:LRRC37 550 619 2.1e-21 PFAM
Pfam:LRRC37 637 704 2.9e-12 PFAM
Pfam:LRRC37 780 851 2.5e-12 PFAM
Pfam:LRRC37 1078 1148 2.7e-18 PFAM
Pfam:LRRC37 1149 1190 2.1e-7 PFAM
Pfam:LRRC37 1187 1258 2.5e-25 PFAM
Pfam:LRRC37 1255 1300 2.6e-7 PFAM
Pfam:LRRC37 1299 1370 2.4e-27 PFAM
Pfam:LRRC37 1369 1420 2.9e-8 PFAM
Pfam:LRRC37 1419 1488 1.3e-24 PFAM
Pfam:LRRC37 1509 1578 9.2e-21 PFAM
Pfam:LRRC37 1575 1620 1.7e-6 PFAM
Pfam:LRRC37 1619 1686 1.7e-20 PFAM
Pfam:LRRC37 1690 1736 7e-10 PFAM
Pfam:LRRC37 1733 1799 7.5e-17 PFAM
Pfam:LRRC37 1789 1854 5.1e-12 PFAM
Pfam:LRRC37 1850 1921 4.2e-21 PFAM
Pfam:LRRC37 1915 1969 1.1e-9 PFAM
low complexity region 2143 2167 N/A INTRINSIC
low complexity region 2185 2209 N/A INTRINSIC
low complexity region 2228 2249 N/A INTRINSIC
low complexity region 2262 2274 N/A INTRINSIC
low complexity region 2284 2297 N/A INTRINSIC
LRR 2419 2438 3.09e1 SMART
LRR 2439 2462 9.96e-1 SMART
LRR 2463 2486 8.24e0 SMART
LRR 2490 2514 3.18e1 SMART
low complexity region 2535 2547 N/A INTRINSIC
coiled coil region 2712 2735 N/A INTRINSIC
low complexity region 2861 2871 N/A INTRINSIC
low complexity region 2937 2950 N/A INTRINSIC
Pfam:LRRC37AB_C 3063 3209 1.1e-77 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (115/115)
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
4931406P16Rik A C 7: 34,245,800 Y552D probably damaging Het
Acot6 A G 12: 84,109,015 K246E probably benign Het
Actl11 T A 9: 107,931,416 H979Q probably damaging Het
Adal T A 2: 121,155,549 probably benign Het
Add2 G A 6: 86,110,858 V596I probably benign Het
Adrb3 A C 8: 27,227,770 M217R probably damaging Het
Akap2 T A 4: 57,856,552 V668E probably benign Het
Ank1 T C 8: 23,141,118 probably benign Het
Ank2 A T 3: 126,963,445 N1054K possibly damaging Het
Ankib1 T C 5: 3,713,217 Y504C probably damaging Het
Ankrd29 T C 18: 12,262,185 K217R probably damaging Het
Ankrd45 T C 1: 161,155,306 V129A probably damaging Het
Aox4 A T 1: 58,236,676 D389V probably benign Het
Aph1a G T 3: 95,895,531 G148W probably damaging Het
Arhgef26 G A 3: 62,340,385 D297N possibly damaging Het
Atxn7l3b C A 10: 112,928,744 probably benign Het
Auh A G 13: 52,841,029 S167P probably damaging Het
Bach1 A T 16: 87,719,000 K143I possibly damaging Het
Bbx T A 16: 50,224,738 T487S probably damaging Het
Bche T G 3: 73,701,844 D83A probably benign Het
Bri3bp G T 5: 125,441,696 probably benign Het
Cd3d A T 9: 44,984,998 E28D probably damaging Het
Cdc42bpa A G 1: 180,137,801 T1028A probably damaging Het
Celsr2 T C 3: 108,412,629 I956V possibly damaging Het
Cep95 A T 11: 106,816,654 probably null Het
Cic G T 7: 25,287,110 G1289C probably damaging Het
Cndp1 A G 18: 84,631,900 Y223H probably damaging Het
Cops8 A G 1: 90,611,002 D51G probably damaging Het
Csgalnact1 T C 8: 68,460,971 E194G probably benign Het
Ctsm A G 13: 61,538,962 Y39H probably damaging Het
Dhrs2 T C 14: 55,237,265 V119A probably damaging Het
Drosha T A 15: 12,935,007 M1336K probably benign Het
Dsp G A 13: 38,197,702 D2808N possibly damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Epas1 A G 17: 86,809,454 N184S probably damaging Het
Erich3 C T 3: 154,748,388 T597I possibly damaging Het
F10 T C 8: 13,055,698 V421A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fcgrt C T 7: 45,101,948 G192D probably benign Het
Fras1 A G 5: 96,650,682 E1184G possibly damaging Het
Gm5155 A G 7: 17,905,218 probably null Het
Gm8989 A T 7: 106,329,457 noncoding transcript Het
Grn C A 11: 102,430,554 probably benign Het
Hadh A T 3: 131,235,548 L274* probably null Het
Hus1 T C 11: 9,006,027 S169G probably damaging Het
Hydin A T 8: 110,563,922 I3338F possibly damaging Het
Ighv11-1 T G 12: 113,982,148 E28D probably benign Het
Kctd9 C T 14: 67,729,356 T106I probably damaging Het
Krit1 A T 5: 3,822,238 N421I probably damaging Het
Lamb1 A G 12: 31,326,678 D1619G probably damaging Het
Lpar6 G A 14: 73,238,707 C36Y probably damaging Het
Lrrc46 A T 11: 97,040,939 V19D probably damaging Het
Mapkap1 G T 2: 34,581,291 S197I probably damaging Het
Mrps35 A C 6: 147,060,147 K173N possibly damaging Het
Mtf2 A G 5: 108,073,028 probably benign Het
Mum1 T C 10: 80,232,868 L282P probably benign Het
Ncf1 A C 5: 134,223,413 D261E probably damaging Het
Notch1 C T 2: 26,481,181 E298K probably damaging Het
Nrxn1 A T 17: 90,620,846 probably benign Het
Olfr110 G T 17: 37,499,126 L158F probably benign Het
Olfr1274-ps T A 2: 90,400,763 M34K probably benign Het
Olfr195 T C 16: 59,149,618 L256P probably damaging Het
Olfr46 C A 7: 140,610,391 A75E possibly damaging Het
Olfr622 A G 7: 103,640,101 F13S probably damaging Het
Otud4 G A 8: 79,655,689 V176I probably damaging Het
Papolg T C 11: 23,873,919 probably null Het
Pgk2 A G 17: 40,207,511 V342A probably damaging Het
Phf2 G A 13: 48,807,844 A790V unknown Het
Prkdc T C 16: 15,673,997 I602T possibly damaging Het
Prl3d3 T C 13: 27,159,089 I86T possibly damaging Het
Prss8 G T 7: 127,926,463 Q295K probably benign Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Qrfpr A G 3: 36,222,136 V35A probably damaging Het
Rpf1 A G 3: 146,506,538 L349S probably damaging Het
Rpl41 G T 10: 128,548,783 probably null Het
Rprd2 G C 3: 95,765,320 R924G probably benign Het
Serpini1 T A 3: 75,614,488 N95K probably benign Het
Sfxn1 A T 13: 54,088,914 T64S probably benign Het
Siae T G 9: 37,646,520 I541S possibly damaging Het
Slc25a4 T A 8: 46,207,472 K296N probably benign Het
Slc37a1 A G 17: 31,322,146 N204S probably damaging Het
Slc9c1 A G 16: 45,593,437 N976S probably benign Het
Smarcal1 T C 1: 72,632,860 S847P possibly damaging Het
Smg1 A T 7: 118,158,100 probably benign Het
Smg1 C T 7: 118,208,051 A168T probably benign Het
Sptlc1 A G 13: 53,351,656 I242T probably damaging Het
St8sia2 T C 7: 73,966,961 I89V possibly damaging Het
Supt20 A T 3: 54,695,134 probably benign Het
Tep1 T C 14: 50,839,000 D1659G probably benign Het
Tex10 C A 4: 48,458,525 probably benign Het
Thbs3 CAGAAG CAG 3: 89,223,102 probably benign Het
Tmbim6 C A 15: 99,402,069 S22* probably null Het
Tmc2 A T 2: 130,202,041 K65M possibly damaging Het
Tmod1 A G 4: 46,090,872 S142G probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trmt6 T C 2: 132,808,271 R349G possibly damaging Het
Ttn T A 2: 76,707,242 T26454S possibly damaging Het
Ttn C T 2: 76,774,778 V16555I probably benign Het
Ubr3 T C 2: 70,020,446 probably benign Het
Vmn1r17 A C 6: 57,360,475 F253V possibly damaging Het
Vmn1r201 G T 13: 22,475,452 A279S possibly damaging Het
Vmn2r17 A T 5: 109,427,873 R203S probably benign Het
Vwa5a A G 9: 38,722,630 E43G probably benign Het
Wdr86 C T 5: 24,712,845 probably null Het
Wdsub1 A T 2: 59,870,414 probably benign Het
Zcchc11 T A 4: 108,526,845 probably benign Het
Zcchc7 T C 4: 44,931,039 L76P probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp263 T C 16: 3,749,128 C148R probably damaging Het
Zfp687 A C 3: 95,010,386 F692V probably damaging Het
Other mutations in Lrrc37a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Lrrc37a APN 11 103500351 missense probably benign 0.09
IGL01339:Lrrc37a APN 11 103497937 missense unknown
IGL01352:Lrrc37a APN 11 103499355 missense probably benign 0.39
IGL01382:Lrrc37a APN 11 103498755 missense probably damaging 0.99
IGL01395:Lrrc37a APN 11 103503861 missense probably benign 0.24
IGL01645:Lrrc37a APN 11 103504264 missense probably benign 0.01
IGL01925:Lrrc37a APN 11 103498419 missense probably benign 0.01
IGL02006:Lrrc37a APN 11 103456491 missense probably damaging 1.00
IGL02127:Lrrc37a APN 11 103504539 missense probably benign 0.01
IGL02184:Lrrc37a APN 11 103497609 missense unknown
IGL02218:Lrrc37a APN 11 103500381 missense probably benign 0.03
IGL02436:Lrrc37a APN 11 103498177 missense unknown
IGL02487:Lrrc37a APN 11 103496037 missense unknown
IGL02597:Lrrc37a APN 11 103504287 missense probably benign 0.01
IGL02634:Lrrc37a APN 11 103499112 missense probably benign 0.09
IGL02818:Lrrc37a APN 11 103501306 missense possibly damaging 0.47
IGL02829:Lrrc37a APN 11 103491174 missense unknown
IGL02987:Lrrc37a APN 11 103500413 missense probably benign 0.03
IGL03081:Lrrc37a APN 11 103456595 missense unknown
IGL03210:Lrrc37a APN 11 103499505 missense probably benign 0.29
IGL03239:Lrrc37a APN 11 103499407 missense probably benign 0.03
IGL03285:Lrrc37a APN 11 103497673 missense unknown
IGL03296:Lrrc37a APN 11 103497673 missense unknown
IGL03299:Lrrc37a APN 11 103497673 missense unknown
IGL03370:Lrrc37a APN 11 103497673 missense unknown
IGL03390:Lrrc37a APN 11 103496031 missense unknown
F5770:Lrrc37a UTSW 11 103455512 missense possibly damaging 0.95
P0035:Lrrc37a UTSW 11 103503132 missense possibly damaging 0.84
PIT4458001:Lrrc37a UTSW 11 103504512 missense probably benign 0.04
R0112:Lrrc37a UTSW 11 103500913 missense probably benign 0.19
R0194:Lrrc37a UTSW 11 103499790 missense possibly damaging 0.82
R0360:Lrrc37a UTSW 11 103500640 missense possibly damaging 0.89
R0364:Lrrc37a UTSW 11 103500640 missense possibly damaging 0.89
R0395:Lrrc37a UTSW 11 103464395 missense unknown
R0418:Lrrc37a UTSW 11 103503438 missense probably benign 0.03
R0505:Lrrc37a UTSW 11 103503025 missense probably benign 0.10
R0583:Lrrc37a UTSW 11 103498437 missense probably benign 0.01
R1078:Lrrc37a UTSW 11 103497631 missense unknown
R1581:Lrrc37a UTSW 11 103457017 nonsense probably null
R1888:Lrrc37a UTSW 11 103498761 missense probably benign 0.18
R1888:Lrrc37a UTSW 11 103498761 missense probably benign 0.18
R1907:Lrrc37a UTSW 11 103457156 missense unknown
R1982:Lrrc37a UTSW 11 103498966 missense probably benign 0.20
R1991:Lrrc37a UTSW 11 103500261 missense probably benign 0.29
R2017:Lrrc37a UTSW 11 103501125 missense probably benign 0.03
R2103:Lrrc37a UTSW 11 103500261 missense probably benign 0.29
R2110:Lrrc37a UTSW 11 103497822 missense unknown
R2190:Lrrc37a UTSW 11 103500043 missense possibly damaging 0.82
R2252:Lrrc37a UTSW 11 103501467 missense probably benign 0.01
R2253:Lrrc37a UTSW 11 103501467 missense probably benign 0.01
R2894:Lrrc37a UTSW 11 103497864 missense unknown
R2899:Lrrc37a UTSW 11 103497864 missense unknown
R3439:Lrrc37a UTSW 11 103497864 missense unknown
R3899:Lrrc37a UTSW 11 103497546 missense unknown
R3916:Lrrc37a UTSW 11 103455518 missense possibly damaging 0.83
R3921:Lrrc37a UTSW 11 103501470 missense probably benign 0.10
R3977:Lrrc37a UTSW 11 103457604 missense unknown
R4043:Lrrc37a UTSW 11 103498653 missense possibly damaging 0.95
R4077:Lrrc37a UTSW 11 103497982 missense unknown
R4237:Lrrc37a UTSW 11 103502289 missense probably damaging 0.97
R4461:Lrrc37a UTSW 11 103464354 critical splice donor site probably null
R4498:Lrrc37a UTSW 11 103501798 missense probably benign 0.20
R4593:Lrrc37a UTSW 11 103498969 missense possibly damaging 0.64
R4670:Lrrc37a UTSW 11 103504537 missense probably benign 0.10
R4698:Lrrc37a UTSW 11 103504104 missense possibly damaging 0.83
R4750:Lrrc37a UTSW 11 103455480 missense probably benign 0.24
R4805:Lrrc37a UTSW 11 103504309 missense probably benign 0.01
R4940:Lrrc37a UTSW 11 103497612 missense unknown
R4983:Lrrc37a UTSW 11 103497618 missense unknown
R5046:Lrrc37a UTSW 11 103498240 missense unknown
R5217:Lrrc37a UTSW 11 103456954 missense unknown
R5300:Lrrc37a UTSW 11 103456958 missense unknown
R5509:Lrrc37a UTSW 11 103500535 missense probably benign 0.23
R5550:Lrrc37a UTSW 11 103498177 missense unknown
R5655:Lrrc37a UTSW 11 103498555 missense probably benign 0.28
R5668:Lrrc37a UTSW 11 103500175 missense probably benign 0.03
R5750:Lrrc37a UTSW 11 103458097 missense unknown
R5815:Lrrc37a UTSW 11 103503786 missense probably benign 0.01
R5976:Lrrc37a UTSW 11 103499071 missense possibly damaging 0.73
R5990:Lrrc37a UTSW 11 103500958 missense probably benign 0.19
R6004:Lrrc37a UTSW 11 103502536 missense possibly damaging 0.56
R6019:Lrrc37a UTSW 11 103456596 missense unknown
R6056:Lrrc37a UTSW 11 103497658 missense unknown
R6125:Lrrc37a UTSW 11 103501560 missense probably benign 0.19
R6190:Lrrc37a UTSW 11 103501216 missense possibly damaging 0.67
R6295:Lrrc37a UTSW 11 103497633 missense unknown
R6320:Lrrc37a UTSW 11 103504051 missense probably benign 0.10
R6354:Lrrc37a UTSW 11 103464387 missense unknown
R6375:Lrrc37a UTSW 11 103501089 missense probably benign 0.19
R6406:Lrrc37a UTSW 11 103497535 missense unknown
R6468:Lrrc37a UTSW 11 103460840 missense unknown
R6490:Lrrc37a UTSW 11 103456660 missense unknown
R6502:Lrrc37a UTSW 11 103492179 missense unknown
R6509:Lrrc37a UTSW 11 103504414 missense probably benign 0.04
R6749:Lrrc37a UTSW 11 103502097 missense probably benign 0.29
R6768:Lrrc37a UTSW 11 103500123 missense probably benign 0.36
R6912:Lrrc37a UTSW 11 103457543 missense unknown
R7081:Lrrc37a UTSW 11 103457955 missense unknown
R7083:Lrrc37a UTSW 11 103503340 missense probably benign 0.03
R7154:Lrrc37a UTSW 11 103502856 missense probably benign 0.03
R7195:Lrrc37a UTSW 11 103457775 missense unknown
R7265:Lrrc37a UTSW 11 103498941 missense probably benign 0.09
R7276:Lrrc37a UTSW 11 103456746 missense unknown
R7362:Lrrc37a UTSW 11 103457509 missense unknown
R7450:Lrrc37a UTSW 11 103498326 missense probably benign 0.01
R7458:Lrrc37a UTSW 11 103497432 missense unknown
R7487:Lrrc37a UTSW 11 103498219 missense unknown
R7535:Lrrc37a UTSW 11 103501857 missense possibly damaging 0.68
R7593:Lrrc37a UTSW 11 103500952 missense probably benign 0.03
R7677:Lrrc37a UTSW 11 103499638 missense probably benign 0.26
R7686:Lrrc37a UTSW 11 103498236 missense unknown
R7694:Lrrc37a UTSW 11 103504378 missense probably benign 0.12
R7696:Lrrc37a UTSW 11 103498437 missense probably benign 0.01
R7717:Lrrc37a UTSW 11 103504300 missense probably benign 0.01
R7736:Lrrc37a UTSW 11 103497459 missense unknown
R7841:Lrrc37a UTSW 11 103501105 missense probably benign 0.03
R7885:Lrrc37a UTSW 11 103503042 missense probably benign 0.01
R7888:Lrrc37a UTSW 11 103501481 missense probably benign 0.19
R7993:Lrrc37a UTSW 11 103457961 missense unknown
R8051:Lrrc37a UTSW 11 103503126 missense possibly damaging 0.48
R8082:Lrrc37a UTSW 11 103457422 missense unknown
R8097:Lrrc37a UTSW 11 103504099 missense probably benign 0.04
R8108:Lrrc37a UTSW 11 103503057 missense probably benign 0.24
R8269:Lrrc37a UTSW 11 103497898 missense unknown
R8311:Lrrc37a UTSW 11 103503421 missense probably benign 0.05
R8403:Lrrc37a UTSW 11 103501585 missense probably benign 0.10
R8408:Lrrc37a UTSW 11 103460809 missense unknown
V7580:Lrrc37a UTSW 11 103455512 missense possibly damaging 0.95
X0018:Lrrc37a UTSW 11 103499544 missense possibly damaging 0.78
Z1176:Lrrc37a UTSW 11 103456486 missense probably damaging 1.00
Z1176:Lrrc37a UTSW 11 103499034 missense possibly damaging 0.68
Z1176:Lrrc37a UTSW 11 103501094 missense probably benign 0.09
Z1177:Lrrc37a UTSW 11 103499967 missense possibly damaging 0.46
Z1177:Lrrc37a UTSW 11 103500520 missense probably benign 0.43
Z1177:Lrrc37a UTSW 11 103500598 missense probably benign 0.20
Z1177:Lrrc37a UTSW 11 103503027 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TGGAGATGAGCTTGGCACAG -3'
(R):5'- CTTGAAGAAAATCGGGCTGCAAC -3'

Sequencing Primer
(F):5'- TTGGCACAGGACATTTGCAC -3'
(R):5'- TCGGGCTGCAACAGATAATG -3'
Posted On2016-05-10