Mutagenetix > Incidental Mutation

Incidental Mutation 'R4989:Dsp'

386069

Institutional Source

Beutler Lab

Gene Symbol

Dsp

Ensembl Gene

ENSMUSG00000054889

Gene Name

desmoplakin

Synonyms

5730453H04Rik, DP, 2300002E22Rik

MMRRC Submission

042583-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4989 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

38151294-38198577 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 38197702 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 2808 (D2808N)

Ref Sequence

ENSEMBL: ENSMUSP00000115062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124830
AA Change: D2808N

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: D2808N

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-96	BLAST
Blast:SPEC	783	894	4e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1370	N/A	INTRINSIC
coiled coil region	1394	1956	N/A	INTRINSIC
low complexity region	1997	2011	N/A	INTRINSIC
PLEC	2021	2057	3.33e-1	SMART
PLEC	2058	2095	3.76e-9	SMART
PLEC	2096	2133	4.09e-10	SMART
PLEC	2134	2171	2.09e-7	SMART
PLEC	2175	2209	4.83e1	SMART
PLEC	2210	2245	5.67e1	SMART
PLEC	2263	2300	1.22e-8	SMART
PLEC	2301	2338	1.16e-9	SMART
PLEC	2339	2376	1.12e-7	SMART
PLEC	2377	2414	1.56e-6	SMART
PLEC	2418	2452	1.42e0	SMART
PLEC	2468	2505	3.7e-8	SMART
low complexity region	2507	2517	N/A	INTRINSIC
PLEC	2519	2556	3.73e-4	SMART
low complexity region	2577	2593	N/A	INTRINSIC
PLEC	2622	2659	1.46e-6	SMART
PLEC	2660	2697	6.69e-15	SMART
PLEC	2698	2735	1.98e2	SMART
PLEC	2736	2773	2.35e-10	SMART
PLEC	2774	2811	1.39e-3	SMART
low complexity region	2835	2860	N/A	INTRINSIC
low complexity region	2867	2879	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000127906
AA Change: D2209N

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889
AA Change: D2209N

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-95	BLAST
Blast:SPEC	783	894	3e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1357	N/A	INTRINSIC
low complexity region	1398	1412	N/A	INTRINSIC
PLEC	1422	1458	3.33e-1	SMART
PLEC	1459	1496	3.76e-9	SMART
PLEC	1497	1534	4.09e-10	SMART
PLEC	1535	1572	2.09e-7	SMART
PLEC	1576	1610	4.83e1	SMART
PLEC	1611	1646	5.67e1	SMART
PLEC	1664	1701	1.22e-8	SMART
PLEC	1702	1739	1.16e-9	SMART
PLEC	1740	1777	1.12e-7	SMART
PLEC	1778	1815	1.56e-6	SMART
PLEC	1819	1853	1.42e0	SMART
PLEC	1869	1906	3.7e-8	SMART
low complexity region	1908	1918	N/A	INTRINSIC
PLEC	1920	1957	3.73e-4	SMART
low complexity region	1978	1994	N/A	INTRINSIC
PLEC	2023	2060	1.46e-6	SMART
PLEC	2061	2098	6.69e-15	SMART
PLEC	2099	2136	1.98e2	SMART
PLEC	2137	2174	2.35e-10	SMART
PLEC	2175	2212	1.39e-3	SMART
low complexity region	2236	2261	N/A	INTRINSIC
low complexity region	2268	2280	N/A	INTRINSIC

Meta Mutation Damage Score

0.1785

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

100% (115/115)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 114 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
4931406P16Rik	A	C	7: 34,245,800	Y552D	probably damaging	Het
Acot6	A	G	12: 84,109,015	K246E	probably benign	Het
Actl11	T	A	9: 107,931,416	H979Q	probably damaging	Het
Adal	T	A	2: 121,155,549		probably benign	Het
Add2	G	A	6: 86,110,858	V596I	probably benign	Het
Adrb3	A	C	8: 27,227,770	M217R	probably damaging	Het
Akap2	T	A	4: 57,856,552	V668E	probably benign	Het
Ank1	T	C	8: 23,141,118		probably benign	Het
Ank2	A	T	3: 126,963,445	N1054K	possibly damaging	Het
Ankib1	T	C	5: 3,713,217	Y504C	probably damaging	Het
Ankrd29	T	C	18: 12,262,185	K217R	probably damaging	Het
Ankrd45	T	C	1: 161,155,306	V129A	probably damaging	Het
Aox4	A	T	1: 58,236,676	D389V	probably benign	Het
Aph1a	G	T	3: 95,895,531	G148W	probably damaging	Het
Arhgef26	G	A	3: 62,340,385	D297N	possibly damaging	Het
Atxn7l3b	C	A	10: 112,928,744		probably benign	Het
Auh	A	G	13: 52,841,029	S167P	probably damaging	Het
Bach1	A	T	16: 87,719,000	K143I	possibly damaging	Het
Bbx	T	A	16: 50,224,738	T487S	probably damaging	Het
Bche	T	G	3: 73,701,844	D83A	probably benign	Het
Bri3bp	G	T	5: 125,441,696		probably benign	Het
Cd3d	A	T	9: 44,984,998	E28D	probably damaging	Het
Cdc42bpa	A	G	1: 180,137,801	T1028A	probably damaging	Het
Celsr2	T	C	3: 108,412,629	I956V	possibly damaging	Het
Cep95	A	T	11: 106,816,654		probably null	Het
Cic	G	T	7: 25,287,110	G1289C	probably damaging	Het
Cndp1	A	G	18: 84,631,900	Y223H	probably damaging	Het
Cops8	A	G	1: 90,611,002	D51G	probably damaging	Het
Csgalnact1	T	C	8: 68,460,971	E194G	probably benign	Het
Ctsm	A	G	13: 61,538,962	Y39H	probably damaging	Het
Dhrs2	T	C	14: 55,237,265	V119A	probably damaging	Het
Drosha	T	A	15: 12,935,007	M1336K	probably benign	Het
Ehmt1	G	T	2: 24,877,497	P135T	probably damaging	Het
Epas1	A	G	17: 86,809,454	N184S	probably damaging	Het
Erich3	C	T	3: 154,748,388	T597I	possibly damaging	Het
F10	T	C	8: 13,055,698	V421A	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam227b	G	A	2: 126,116,123	P241S	probably damaging	Het
Fcgrt	C	T	7: 45,101,948	G192D	probably benign	Het
Fras1	A	G	5: 96,650,682	E1184G	possibly damaging	Het
Gm5155	A	G	7: 17,905,218		probably null	Het
Gm8989	A	T	7: 106,329,457		noncoding transcript	Het
Grn	C	A	11: 102,430,554		probably benign	Het
Hadh	A	T	3: 131,235,548	L274*	probably null	Het
Hus1	T	C	11: 9,006,027	S169G	probably damaging	Het
Hydin	A	T	8: 110,563,922	I3338F	possibly damaging	Het
Ighv11-1	T	G	12: 113,982,148	E28D	probably benign	Het
Kctd9	C	T	14: 67,729,356	T106I	probably damaging	Het
Krit1	A	T	5: 3,822,238	N421I	probably damaging	Het
Lamb1	A	G	12: 31,326,678	D1619G	probably damaging	Het
Lpar6	G	A	14: 73,238,707	C36Y	probably damaging	Het
Lrrc37a	G	C	11: 103,456,739	F3043L	unknown	Het
Lrrc46	A	T	11: 97,040,939	V19D	probably damaging	Het
Mapkap1	G	T	2: 34,581,291	S197I	probably damaging	Het
Mrps35	A	C	6: 147,060,147	K173N	possibly damaging	Het
Mtf2	A	G	5: 108,073,028		probably benign	Het
Mum1	T	C	10: 80,232,868	L282P	probably benign	Het
Ncf1	A	C	5: 134,223,413	D261E	probably damaging	Het
Notch1	C	T	2: 26,481,181	E298K	probably damaging	Het
Nrxn1	A	T	17: 90,620,846		probably benign	Het
Olfr110	G	T	17: 37,499,126	L158F	probably benign	Het
Olfr1274-ps	T	A	2: 90,400,763	M34K	probably benign	Het
Olfr195	T	C	16: 59,149,618	L256P	probably damaging	Het
Olfr46	C	A	7: 140,610,391	A75E	possibly damaging	Het
Olfr622	A	G	7: 103,640,101	F13S	probably damaging	Het
Otud4	G	A	8: 79,655,689	V176I	probably damaging	Het
Papolg	T	C	11: 23,873,919		probably null	Het
Pgk2	A	G	17: 40,207,511	V342A	probably damaging	Het
Phf2	G	A	13: 48,807,844	A790V	unknown	Het
Prkdc	T	C	16: 15,673,997	I602T	possibly damaging	Het
Prl3d3	T	C	13: 27,159,089	I86T	possibly damaging	Het
Prss8	G	T	7: 127,926,463	Q295K	probably benign	Het
Ptpre	C	T	7: 135,669,132	H346Y	probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Qrfpr	A	G	3: 36,222,136	V35A	probably damaging	Het
Rpf1	A	G	3: 146,506,538	L349S	probably damaging	Het
Rpl41	G	T	10: 128,548,783		probably null	Het
Rprd2	G	C	3: 95,765,320	R924G	probably benign	Het
Serpini1	T	A	3: 75,614,488	N95K	probably benign	Het
Sfxn1	A	T	13: 54,088,914	T64S	probably benign	Het
Siae	T	G	9: 37,646,520	I541S	possibly damaging	Het
Slc25a4	T	A	8: 46,207,472	K296N	probably benign	Het
Slc37a1	A	G	17: 31,322,146	N204S	probably damaging	Het
Slc9c1	A	G	16: 45,593,437	N976S	probably benign	Het
Smarcal1	T	C	1: 72,632,860	S847P	possibly damaging	Het
Smg1	A	T	7: 118,158,100		probably benign	Het
Smg1	C	T	7: 118,208,051	A168T	probably benign	Het
Sptlc1	A	G	13: 53,351,656	I242T	probably damaging	Het
St8sia2	T	C	7: 73,966,961	I89V	possibly damaging	Het
Supt20	A	T	3: 54,695,134		probably benign	Het
Tep1	T	C	14: 50,839,000	D1659G	probably benign	Het
Tex10	C	A	4: 48,458,525		probably benign	Het
Thbs3	CAGAAG	CAG	3: 89,223,102		probably benign	Het
Tmbim6	C	A	15: 99,402,069	S22*	probably null	Het
Tmc2	A	T	2: 130,202,041	K65M	possibly damaging	Het
Tmod1	A	G	4: 46,090,872	S142G	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trmt6	T	C	2: 132,808,271	R349G	possibly damaging	Het
Ttn	T	A	2: 76,707,242	T26454S	possibly damaging	Het
Ttn	C	T	2: 76,774,778	V16555I	probably benign	Het
Ubr3	T	C	2: 70,020,446		probably benign	Het
Vmn1r17	A	C	6: 57,360,475	F253V	possibly damaging	Het
Vmn1r201	G	T	13: 22,475,452	A279S	possibly damaging	Het
Vmn2r17	A	T	5: 109,427,873	R203S	probably benign	Het
Vwa5a	A	G	9: 38,722,630	E43G	probably benign	Het
Wdr86	C	T	5: 24,712,845		probably null	Het
Wdsub1	A	T	2: 59,870,414		probably benign	Het
Zcchc11	T	A	4: 108,526,845		probably benign	Het
Zcchc7	T	C	4: 44,931,039	L76P	probably damaging	Het
Zfp108	G	T	7: 24,260,738	K251N	probably benign	Het
Zfp263	T	C	16: 3,749,128	C148R	probably damaging	Het
Zfp687	A	C	3: 95,010,386	F692V	probably damaging	Het

Other mutations in Dsp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Dsp	APN	13	38197846	missense	probably damaging	0.99
IGL01337:Dsp	APN	13	38192687	missense	probably benign	0.44
IGL01371:Dsp	APN	13	38193617	missense	probably benign	0.13
IGL01473:Dsp	APN	13	38167571	missense	probably damaging	0.99
IGL01660:Dsp	APN	13	38176495	missense	possibly damaging	0.90
IGL01723:Dsp	APN	13	38179084	missense	probably damaging	1.00
IGL01999:Dsp	APN	13	38181186	missense	probably damaging	0.99
IGL02313:Dsp	APN	13	38196523	nonsense	probably null
IGL02833:Dsp	APN	13	38192921	missense	possibly damaging	0.56
IGL03050:Dsp	APN	13	38188445	splice site	probably benign
IGL03353:Dsp	APN	13	38186695	missense	probably damaging	1.00
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0078:Dsp	UTSW	13	38196017	missense	probably benign	0.22
R0230:Dsp	UTSW	13	38197705	missense	probably benign	0.03
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0285:Dsp	UTSW	13	38172794	missense	probably benign
R0326:Dsp	UTSW	13	38192870	nonsense	probably null
R0332:Dsp	UTSW	13	38182228	nonsense	probably null
R0471:Dsp	UTSW	13	38193350	nonsense	probably null
R0567:Dsp	UTSW	13	38192438	missense	probably benign	0.01
R0611:Dsp	UTSW	13	38187741	missense	probably damaging	1.00
R0718:Dsp	UTSW	13	38196764	missense	possibly damaging	0.80
R0926:Dsp	UTSW	13	38183218	missense	probably damaging	0.97
R1078:Dsp	UTSW	13	38183106	splice site	probably benign
R1183:Dsp	UTSW	13	38191740	nonsense	probably null
R1188:Dsp	UTSW	13	38194963	missense	probably damaging	1.00
R1419:Dsp	UTSW	13	38186695	missense	probably damaging	1.00
R1445:Dsp	UTSW	13	38191931	missense	probably damaging	0.98
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1478:Dsp	UTSW	13	38181138	missense	probably damaging	1.00
R1568:Dsp	UTSW	13	38175147	missense	probably damaging	1.00
R1572:Dsp	UTSW	13	38195738	missense	probably damaging	1.00
R1676:Dsp	UTSW	13	38193374	nonsense	probably null
R1736:Dsp	UTSW	13	38192990	missense	probably benign	0.01
R1776:Dsp	UTSW	13	38196617	missense	probably damaging	0.99
R1829:Dsp	UTSW	13	38193195	missense	probably damaging	1.00
R1878:Dsp	UTSW	13	38164855	missense	possibly damaging	0.53
R2013:Dsp	UTSW	13	38191458	missense	probably damaging	1.00
R2161:Dsp	UTSW	13	38196451	missense	probably damaging	1.00
R2187:Dsp	UTSW	13	38176407	missense	probably damaging	1.00
R2295:Dsp	UTSW	13	38197046	missense	probably benign	0.28
R2495:Dsp	UTSW	13	38193477	missense	possibly damaging	0.91
R2566:Dsp	UTSW	13	38196404	missense	probably damaging	1.00
R2888:Dsp	UTSW	13	38192248	missense	possibly damaging	0.92
R3012:Dsp	UTSW	13	38193342	missense	possibly damaging	0.61
R3614:Dsp	UTSW	13	38177199	missense	probably damaging	0.98
R3725:Dsp	UTSW	13	38194689	splice site	probably null
R3725:Dsp	UTSW	13	38197618	missense	probably benign	0.00
R3797:Dsp	UTSW	13	38177284	critical splice donor site	probably null
R3841:Dsp	UTSW	13	38197705	missense	probably benign
R4030:Dsp	UTSW	13	38191428	missense	possibly damaging	0.84
R4124:Dsp	UTSW	13	38186713	missense	probably damaging	1.00
R4279:Dsp	UTSW	13	38185231	missense	probably damaging	1.00
R4334:Dsp	UTSW	13	38196664	missense	possibly damaging	0.46
R4419:Dsp	UTSW	13	38195132	missense	probably damaging	1.00
R4615:Dsp	UTSW	13	38191632	missense	probably damaging	0.98
R4627:Dsp	UTSW	13	38168641	missense	probably benign	0.01
R4639:Dsp	UTSW	13	38196784	missense	probably damaging	1.00
R4687:Dsp	UTSW	13	38191619	missense	probably damaging	1.00
R4735:Dsp	UTSW	13	38196040	missense	probably damaging	0.99
R4746:Dsp	UTSW	13	38195104	missense	possibly damaging	0.51
R4772:Dsp	UTSW	13	38167528	nonsense	probably null
R4830:Dsp	UTSW	13	38192864	missense	probably benign
R4850:Dsp	UTSW	13	38192469	missense	probably damaging	1.00
R4959:Dsp	UTSW	13	38191710	missense	probably benign	0.41
R4963:Dsp	UTSW	13	38197870	missense	probably damaging	0.99
R4969:Dsp	UTSW	13	38192910	missense	probably benign	0.00
R4978:Dsp	UTSW	13	38182234	missense	probably damaging	1.00
R5068:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5069:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5070:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5133:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5138:Dsp	UTSW	13	38183298	missense	probably benign	0.37
R5138:Dsp	UTSW	13	38195845	missense	possibly damaging	0.50
R5153:Dsp	UTSW	13	38182306	missense	probably damaging	1.00
R5199:Dsp	UTSW	13	38192902	nonsense	probably null
R5226:Dsp	UTSW	13	38186770	missense	probably damaging	0.99
R5265:Dsp	UTSW	13	38195183	missense	possibly damaging	0.95
R5371:Dsp	UTSW	13	38194889	missense	probably damaging	0.97
R5484:Dsp	UTSW	13	38184038	missense	possibly damaging	0.48
R5534:Dsp	UTSW	13	38195842	missense	probably benign	0.01
R5569:Dsp	UTSW	13	38192652	missense	probably benign	0.01
R5854:Dsp	UTSW	13	38167501	splice site	probably null
R5910:Dsp	UTSW	13	38192469	missense	possibly damaging	0.95
R5929:Dsp	UTSW	13	38195434	missense	possibly damaging	0.92
R5940:Dsp	UTSW	13	38196026	missense	possibly damaging	0.70
R5948:Dsp	UTSW	13	38195401	missense	possibly damaging	0.95
R5955:Dsp	UTSW	13	38194958	missense	possibly damaging	0.73
R5970:Dsp	UTSW	13	38195702	missense	possibly damaging	0.93
R6054:Dsp	UTSW	13	38167609	missense	probably benign	0.00
R6113:Dsp	UTSW	13	38192047	missense	probably damaging	1.00
R6139:Dsp	UTSW	13	38192406	missense	probably damaging	0.97
R6328:Dsp	UTSW	13	38197006	nonsense	probably null
R6527:Dsp	UTSW	13	38195873	missense	probably damaging	1.00
R6573:Dsp	UTSW	13	38196862	missense	probably damaging	1.00
R6628:Dsp	UTSW	13	38167622	missense	possibly damaging	0.73
R6738:Dsp	UTSW	13	38192210	missense	possibly damaging	0.87
R6898:Dsp	UTSW	13	38192217	missense	possibly damaging	0.59
R6919:Dsp	UTSW	13	38167655	missense	possibly damaging	0.84
R6951:Dsp	UTSW	13	38167646	missense	possibly damaging	0.95
R7017:Dsp	UTSW	13	38186707	missense	probably benign	0.02
R7022:Dsp	UTSW	13	38191740	missense	probably benign	0.06
R7135:Dsp	UTSW	13	38179073	missense	probably damaging	1.00
R7192:Dsp	UTSW	13	38195593	missense	probably benign	0.09
R7211:Dsp	UTSW	13	38188535	critical splice donor site	probably null
R7251:Dsp	UTSW	13	38193548	missense	probably benign	0.02
R7326:Dsp	UTSW	13	38192883	missense	probably benign	0.01
R7369:Dsp	UTSW	13	38197525	missense	possibly damaging	0.82
R7376:Dsp	UTSW	13	38172843	missense	probably damaging	1.00
R7406:Dsp	UTSW	13	38197196	missense	possibly damaging	0.63
R7439:Dsp	UTSW	13	38176502	critical splice donor site	probably null
R7439:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7441:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7477:Dsp	UTSW	13	38172863	missense	probably damaging	1.00
R7535:Dsp	UTSW	13	38192789	missense	probably benign	0.05
R7558:Dsp	UTSW	13	38168766	missense	probably benign	0.02
R7600:Dsp	UTSW	13	38191715	missense	probably damaging	1.00
R7616:Dsp	UTSW	13	38191482	missense	probably damaging	0.98
R7702:Dsp	UTSW	13	38175207	missense	possibly damaging	0.83
R7738:Dsp	UTSW	13	38185175	missense	probably damaging	0.97
R7815:Dsp	UTSW	13	38191470	missense	probably benign	0.31
R7882:Dsp	UTSW	13	38184018	missense	possibly damaging	0.76
R7917:Dsp	UTSW	13	38167639	nonsense	probably null
R7971:Dsp	UTSW	13	38192523	missense	probably damaging	0.97
R8104:Dsp	UTSW	13	38168624	missense	probably benign	0.03
R8176:Dsp	UTSW	13	38192810	missense	possibly damaging	0.56
R8303:Dsp	UTSW	13	38197343	missense	probably benign
R8323:Dsp	UTSW	13	38172830	missense	possibly damaging	0.80
R8326:Dsp	UTSW	13	38191635	missense	probably damaging	1.00
R8358:Dsp	UTSW	13	38192481	missense	possibly damaging	0.92
R8410:Dsp	UTSW	13	38196815	missense	possibly damaging	0.94
R8552:Dsp	UTSW	13	38185141	missense	probably damaging	0.98
R8713:Dsp	UTSW	13	38168725	missense	probably damaging	0.99
R8801:Dsp	UTSW	13	38197526	missense	possibly damaging	0.81
R8900:Dsp	UTSW	13	38181179	missense	probably damaging	0.99
R8901:Dsp	UTSW	13	38181179	missense	probably damaging	0.99
R8968:Dsp	UTSW	13	38151620	missense	possibly damaging	0.83
R9014:Dsp	UTSW	13	38192724	missense	possibly damaging	0.83
R9021:Dsp	UTSW	13	38196832	missense	possibly damaging	0.61
R9030:Dsp	UTSW	13	38168697	missense	probably damaging	1.00
R9124:Dsp	UTSW	13	38193300	missense	probably benign	0.42
R9129:Dsp	UTSW	13	38193150	missense	probably benign	0.09
R9143:Dsp	UTSW	13	38193361	missense	probably benign	0.05
R9450:Dsp	UTSW	13	38192403	missense	probably damaging	1.00
R9488:Dsp	UTSW	13	38193242	missense	probably benign	0.04
R9514:Dsp	UTSW	13	38187805	missense	probably benign	0.02
R9789:Dsp	UTSW	13	38183961	missense	probably benign	0.03
R9792:Dsp	UTSW	13	38195518	missense	possibly damaging	0.87
X0023:Dsp	UTSW	13	38197684	missense	probably benign	0.00
X0024:Dsp	UTSW	13	38193255	missense	probably benign	0.04
X0027:Dsp	UTSW	13	38186646	missense	possibly damaging	0.68
X0067:Dsp	UTSW	13	38182312	missense	possibly damaging	0.85
Z1176:Dsp	UTSW	13	38197190	missense	possibly damaging	0.81
Z1177:Dsp	UTSW	13	38151689	missense	probably benign	0.01
Z1177:Dsp	UTSW	13	38192854	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AAATGGCTTCCCTACGAGGC -3'
(R):5'- AGCATCGAAGCTTCCTCTCC -3'

Sequencing Primer
(F):5'- TGGAGTTCCAGTTCCTCACGG -3'
(R):5'- ATCGAAGCTTCCTCTCCGAGAC -3'

Posted On

2016-05-10