Incidental Mutation 'R4989:Tep1'
ID386075
Institutional Source Beutler Lab
Gene Symbol Tep1
Ensembl Gene ENSMUSG00000006281
Gene Nametelomerase associated protein 1
SynonymsTp1
MMRRC Submission 042583-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4989 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50824059-50870560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50839000 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1659 (D1659G)
Ref Sequence ENSEMBL: ENSMUSP00000006444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006444]
Predicted Effect probably benign
Transcript: ENSMUST00000006444
AA Change: D1659G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006444
Gene: ENSMUSG00000006281
AA Change: D1659G

DomainStartEndE-ValueType
Pfam:TEP1_N 1 29 2.8e-20 PFAM
Pfam:TEP1_N 31 59 1.4e-20 PFAM
Pfam:TEP1_N 61 89 3.1e-20 PFAM
Pfam:TEP1_N 91 119 3e-20 PFAM
low complexity region 195 207 N/A INTRINSIC
low complexity region 211 229 N/A INTRINSIC
Pfam:TROVE 230 685 3.2e-136 PFAM
Pfam:DUF4062 909 1020 2.4e-22 PFAM
Pfam:NACHT 1171 1346 9.2e-38 PFAM
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1622 1641 N/A INTRINSIC
WD40 1673 1711 2.98e-1 SMART
WD40 1714 1752 5.33e0 SMART
WD40 1755 1794 1.52e-4 SMART
WD40 1797 1835 3.27e-4 SMART
WD40 1838 1877 3.09e-1 SMART
WD40 1880 1919 2.24e-2 SMART
WD40 1925 1962 4.95e0 SMART
WD40 1968 2003 2.29e1 SMART
WD40 2008 2045 1.72e0 SMART
WD40 2058 2097 3.89e-11 SMART
WD40 2103 2142 3.93e-7 SMART
WD40 2145 2182 4.38e-5 SMART
WD40 2184 2232 1.24e0 SMART
WD40 2235 2273 1.14e-3 SMART
WD40 2275 2315 4.46e-1 SMART
Blast:WD40 2316 2353 4e-12 BLAST
WD40 2546 2583 6.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227193
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (115/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a component of the ribonucleoprotein complex responsible for telomerase activity which catalyzes the addition of new telomeres on the chromosome ends. The telomerase-associated proteins are conserved from ciliates to humans. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a disruption in this gene show no obvious phenotype. No changes are seen in telomerase activity or telomere length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4931406P16Rik A C 7: 34,245,800 Y552D probably damaging Het
Acot6 A G 12: 84,109,015 K246E probably benign Het
Actl11 T A 9: 107,931,416 H979Q probably damaging Het
Adal T A 2: 121,155,549 probably benign Het
Add2 G A 6: 86,110,858 V596I probably benign Het
Adrb3 A C 8: 27,227,770 M217R probably damaging Het
Akap2 T A 4: 57,856,552 V668E probably benign Het
Ank1 T C 8: 23,141,118 probably benign Het
Ank2 A T 3: 126,963,445 N1054K possibly damaging Het
Ankib1 T C 5: 3,713,217 Y504C probably damaging Het
Ankrd29 T C 18: 12,262,185 K217R probably damaging Het
Ankrd45 T C 1: 161,155,306 V129A probably damaging Het
Aox4 A T 1: 58,236,676 D389V probably benign Het
Aph1a G T 3: 95,895,531 G148W probably damaging Het
Arhgef26 G A 3: 62,340,385 D297N possibly damaging Het
Atxn7l3b C A 10: 112,928,744 probably benign Het
Auh A G 13: 52,841,029 S167P probably damaging Het
Bach1 A T 16: 87,719,000 K143I possibly damaging Het
Bbx T A 16: 50,224,738 T487S probably damaging Het
Bche T G 3: 73,701,844 D83A probably benign Het
Bri3bp G T 5: 125,441,696 probably benign Het
Cd3d A T 9: 44,984,998 E28D probably damaging Het
Cdc42bpa A G 1: 180,137,801 T1028A probably damaging Het
Celsr2 T C 3: 108,412,629 I956V possibly damaging Het
Cep95 A T 11: 106,816,654 probably null Het
Cic G T 7: 25,287,110 G1289C probably damaging Het
Cndp1 A G 18: 84,631,900 Y223H probably damaging Het
Cops8 A G 1: 90,611,002 D51G probably damaging Het
Csgalnact1 T C 8: 68,460,971 E194G probably benign Het
Ctsm A G 13: 61,538,962 Y39H probably damaging Het
Dhrs2 T C 14: 55,237,265 V119A probably damaging Het
Drosha T A 15: 12,935,007 M1336K probably benign Het
Dsp G A 13: 38,197,702 D2808N possibly damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Epas1 A G 17: 86,809,454 N184S probably damaging Het
Erich3 C T 3: 154,748,388 T597I possibly damaging Het
F10 T C 8: 13,055,698 V421A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fcgrt C T 7: 45,101,948 G192D probably benign Het
Fras1 A G 5: 96,650,682 E1184G possibly damaging Het
Gm5155 A G 7: 17,905,218 probably null Het
Gm8989 A T 7: 106,329,457 noncoding transcript Het
Grn C A 11: 102,430,554 probably benign Het
Hadh A T 3: 131,235,548 L274* probably null Het
Hus1 T C 11: 9,006,027 S169G probably damaging Het
Hydin A T 8: 110,563,922 I3338F possibly damaging Het
Ighv11-1 T G 12: 113,982,148 E28D probably benign Het
Kctd9 C T 14: 67,729,356 T106I probably damaging Het
Krit1 A T 5: 3,822,238 N421I probably damaging Het
Lamb1 A G 12: 31,326,678 D1619G probably damaging Het
Lpar6 G A 14: 73,238,707 C36Y probably damaging Het
Lrrc37a G C 11: 103,456,739 F3043L unknown Het
Lrrc46 A T 11: 97,040,939 V19D probably damaging Het
Mapkap1 G T 2: 34,581,291 S197I probably damaging Het
Mrps35 A C 6: 147,060,147 K173N possibly damaging Het
Mtf2 A G 5: 108,073,028 probably benign Het
Mum1 T C 10: 80,232,868 L282P probably benign Het
Ncf1 A C 5: 134,223,413 D261E probably damaging Het
Notch1 C T 2: 26,481,181 E298K probably damaging Het
Nrxn1 A T 17: 90,620,846 probably benign Het
Olfr110 G T 17: 37,499,126 L158F probably benign Het
Olfr1274-ps T A 2: 90,400,763 M34K probably benign Het
Olfr195 T C 16: 59,149,618 L256P probably damaging Het
Olfr46 C A 7: 140,610,391 A75E possibly damaging Het
Olfr622 A G 7: 103,640,101 F13S probably damaging Het
Otud4 G A 8: 79,655,689 V176I probably damaging Het
Papolg T C 11: 23,873,919 probably null Het
Pgk2 A G 17: 40,207,511 V342A probably damaging Het
Phf2 G A 13: 48,807,844 A790V unknown Het
Prkdc T C 16: 15,673,997 I602T possibly damaging Het
Prl3d3 T C 13: 27,159,089 I86T possibly damaging Het
Prss8 G T 7: 127,926,463 Q295K probably benign Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Qrfpr A G 3: 36,222,136 V35A probably damaging Het
Rpf1 A G 3: 146,506,538 L349S probably damaging Het
Rpl41 G T 10: 128,548,783 probably null Het
Rprd2 G C 3: 95,765,320 R924G probably benign Het
Serpini1 T A 3: 75,614,488 N95K probably benign Het
Sfxn1 A T 13: 54,088,914 T64S probably benign Het
Siae T G 9: 37,646,520 I541S possibly damaging Het
Slc25a4 T A 8: 46,207,472 K296N probably benign Het
Slc37a1 A G 17: 31,322,146 N204S probably damaging Het
Slc9c1 A G 16: 45,593,437 N976S probably benign Het
Smarcal1 T C 1: 72,632,860 S847P possibly damaging Het
Smg1 A T 7: 118,158,100 probably benign Het
Smg1 C T 7: 118,208,051 A168T probably benign Het
Sptlc1 A G 13: 53,351,656 I242T probably damaging Het
St8sia2 T C 7: 73,966,961 I89V possibly damaging Het
Supt20 A T 3: 54,695,134 probably benign Het
Tex10 C A 4: 48,458,525 probably benign Het
Thbs3 CAGAAG CAG 3: 89,223,102 probably benign Het
Tmbim6 C A 15: 99,402,069 S22* probably null Het
Tmc2 A T 2: 130,202,041 K65M possibly damaging Het
Tmod1 A G 4: 46,090,872 S142G probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trmt6 T C 2: 132,808,271 R349G possibly damaging Het
Ttn T A 2: 76,707,242 T26454S possibly damaging Het
Ttn C T 2: 76,774,778 V16555I probably benign Het
Ubr3 T C 2: 70,020,446 probably benign Het
Vmn1r17 A C 6: 57,360,475 F253V possibly damaging Het
Vmn1r201 G T 13: 22,475,452 A279S possibly damaging Het
Vmn2r17 A T 5: 109,427,873 R203S probably benign Het
Vwa5a A G 9: 38,722,630 E43G probably benign Het
Wdr86 C T 5: 24,712,845 probably null Het
Wdsub1 A T 2: 59,870,414 probably benign Het
Zcchc11 T A 4: 108,526,845 probably benign Het
Zcchc7 T C 4: 44,931,039 L76P probably damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp263 T C 16: 3,749,128 C148R probably damaging Het
Zfp687 A C 3: 95,010,386 F692V probably damaging Het
Other mutations in Tep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Tep1 APN 14 50843184 missense probably damaging 1.00
IGL00490:Tep1 APN 14 50833473 missense probably damaging 0.97
IGL01114:Tep1 APN 14 50850639 missense probably damaging 0.98
IGL01294:Tep1 APN 14 50829657 splice site probably benign
IGL01902:Tep1 APN 14 50866091 splice site probably benign
IGL01910:Tep1 APN 14 50844112 missense probably benign 0.06
IGL01925:Tep1 APN 14 50824498 unclassified probably benign
IGL01965:Tep1 APN 14 50863495 splice site probably benign
IGL02071:Tep1 APN 14 50834049 missense possibly damaging 0.93
IGL02124:Tep1 APN 14 50854124 unclassified probably benign
IGL02189:Tep1 APN 14 50826826 missense probably benign
IGL02252:Tep1 APN 14 50830255 missense possibly damaging 0.93
IGL02299:Tep1 APN 14 50840671 missense probably damaging 0.99
IGL02343:Tep1 APN 14 50829247 missense probably damaging 0.99
IGL02423:Tep1 APN 14 50844620 missense possibly damaging 0.53
IGL02537:Tep1 APN 14 50836113 missense probably damaging 0.96
IGL02601:Tep1 APN 14 50833478 nonsense probably null
IGL02941:Tep1 APN 14 50866037 missense probably damaging 0.98
IGL02990:Tep1 APN 14 50868246 missense possibly damaging 0.86
IGL03144:Tep1 APN 14 50844017 splice site probably benign
IGL03209:Tep1 APN 14 50840703 splice site probably benign
PIT4305001:Tep1 UTSW 14 50829227 missense possibly damaging 0.90
PIT4362001:Tep1 UTSW 14 50866053 missense probably benign 0.23
R0058:Tep1 UTSW 14 50834065 missense possibly damaging 0.85
R0060:Tep1 UTSW 14 50866029 missense probably damaging 1.00
R0109:Tep1 UTSW 14 50851916 splice site probably null
R0123:Tep1 UTSW 14 50829693 missense possibly damaging 0.84
R0134:Tep1 UTSW 14 50829693 missense possibly damaging 0.84
R0148:Tep1 UTSW 14 50824789 missense possibly damaging 0.70
R0240:Tep1 UTSW 14 50863029 splice site probably benign
R0243:Tep1 UTSW 14 50846987 missense probably damaging 1.00
R0373:Tep1 UTSW 14 50836768 missense possibly damaging 0.85
R0432:Tep1 UTSW 14 50866823 small deletion probably benign
R0464:Tep1 UTSW 14 50847684 missense probably benign 0.00
R0566:Tep1 UTSW 14 50845414 critical splice donor site probably null
R0691:Tep1 UTSW 14 50866844 nonsense probably null
R0787:Tep1 UTSW 14 50829230 missense possibly damaging 0.85
R0972:Tep1 UTSW 14 50824296 unclassified probably benign
R1263:Tep1 UTSW 14 50845513 missense possibly damaging 0.84
R1300:Tep1 UTSW 14 50827055 critical splice donor site probably null
R1327:Tep1 UTSW 14 50853099 missense probably benign 0.18
R1556:Tep1 UTSW 14 50853042 missense probably benign 0.06
R1584:Tep1 UTSW 14 50866037 missense probably damaging 0.98
R1607:Tep1 UTSW 14 50824563 missense probably null 0.99
R1686:Tep1 UTSW 14 50836788 missense probably benign 0.12
R1715:Tep1 UTSW 14 50854567 missense possibly damaging 0.92
R1778:Tep1 UTSW 14 50829622 intron probably benign
R1993:Tep1 UTSW 14 50824184 missense possibly damaging 0.93
R2071:Tep1 UTSW 14 50854282 missense probably benign 0.23
R2104:Tep1 UTSW 14 50850580 splice site probably benign
R2118:Tep1 UTSW 14 50855572 intron probably null
R2119:Tep1 UTSW 14 50838986 missense probably benign 0.13
R2208:Tep1 UTSW 14 50866864 missense probably benign 0.01
R2241:Tep1 UTSW 14 50854210 missense probably benign 0.01
R2243:Tep1 UTSW 14 50854210 missense probably benign 0.01
R2311:Tep1 UTSW 14 50833567 missense possibly damaging 0.95
R2420:Tep1 UTSW 14 50834023 missense probably benign
R2874:Tep1 UTSW 14 50850650 missense possibly damaging 0.71
R3084:Tep1 UTSW 14 50827054 critical splice donor site probably null
R3086:Tep1 UTSW 14 50827054 critical splice donor site probably null
R3621:Tep1 UTSW 14 50829020 missense probably damaging 0.99
R3815:Tep1 UTSW 14 50868315 missense possibly damaging 0.71
R4124:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4125:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4127:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4134:Tep1 UTSW 14 50844860 missense probably benign
R4152:Tep1 UTSW 14 50837594 missense possibly damaging 0.72
R4153:Tep1 UTSW 14 50837594 missense possibly damaging 0.72
R4191:Tep1 UTSW 14 50836806 missense probably damaging 0.96
R4248:Tep1 UTSW 14 50862894 missense possibly damaging 0.93
R4293:Tep1 UTSW 14 50846861 missense probably benign
R4569:Tep1 UTSW 14 50824740 missense probably benign 0.01
R4704:Tep1 UTSW 14 50837073 missense probably benign 0.06
R4815:Tep1 UTSW 14 50841302 missense probably damaging 0.99
R4978:Tep1 UTSW 14 50845434 missense possibly damaging 0.93
R5022:Tep1 UTSW 14 50828999 missense probably benign 0.27
R5057:Tep1 UTSW 14 50828999 missense probably benign 0.27
R5063:Tep1 UTSW 14 50850627 missense possibly damaging 0.86
R5118:Tep1 UTSW 14 50855587 splice site probably null
R5128:Tep1 UTSW 14 50844279 makesense probably null
R5149:Tep1 UTSW 14 50837398 nonsense probably null
R5171:Tep1 UTSW 14 50824802 missense probably benign 0.01
R5201:Tep1 UTSW 14 50868110 missense probably benign 0.01
R5260:Tep1 UTSW 14 50838631 missense probably benign
R5339:Tep1 UTSW 14 50844574 missense probably damaging 0.99
R5384:Tep1 UTSW 14 50868317 missense probably damaging 0.98
R5385:Tep1 UTSW 14 50868317 missense probably damaging 0.98
R5386:Tep1 UTSW 14 50868317 missense probably damaging 0.98
R5594:Tep1 UTSW 14 50829882 missense possibly damaging 0.86
R5639:Tep1 UTSW 14 50853605 missense possibly damaging 0.85
R5749:Tep1 UTSW 14 50844072 missense possibly damaging 0.59
R5756:Tep1 UTSW 14 50837379 critical splice donor site probably null
R6013:Tep1 UTSW 14 50861048 missense probably damaging 0.97
R6014:Tep1 UTSW 14 50847000 missense probably benign 0.12
R6248:Tep1 UTSW 14 50830258 missense probably damaging 0.98
R6264:Tep1 UTSW 14 50845513 missense probably damaging 0.99
R6363:Tep1 UTSW 14 50824548 missense probably benign 0.04
R6381:Tep1 UTSW 14 50845431 missense probably damaging 0.99
R6462:Tep1 UTSW 14 50844379 missense probably benign
R6942:Tep1 UTSW 14 50836737 missense possibly damaging 0.85
R6951:Tep1 UTSW 14 50833913 critical splice donor site probably null
R6979:Tep1 UTSW 14 50838637 missense possibly damaging 0.93
R6999:Tep1 UTSW 14 50850705 missense possibly damaging 0.86
R7099:Tep1 UTSW 14 50844487 intron probably null
R7208:Tep1 UTSW 14 50824556 critical splice acceptor site probably null
R7232:Tep1 UTSW 14 50844332 missense unknown
R7249:Tep1 UTSW 14 50824275 missense possibly damaging 0.86
R7325:Tep1 UTSW 14 50866038 missense probably damaging 0.99
R7409:Tep1 UTSW 14 50866855 missense possibly damaging 0.67
R7499:Tep1 UTSW 14 50853590 missense probably damaging 0.99
R7542:Tep1 UTSW 14 50862491 nonsense probably null
R7806:Tep1 UTSW 14 50836809 missense possibly damaging 0.85
R7825:Tep1 UTSW 14 50843887 critical splice acceptor site probably null
RF007:Tep1 UTSW 14 50860945 missense possibly damaging 0.92
X0024:Tep1 UTSW 14 50827119 missense possibly damaging 0.86
X0060:Tep1 UTSW 14 50836764 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CAGTAGTTCTGGTCTCTTCTGCC -3'
(R):5'- TGAAGCCAACCAGAAGCTCC -3'

Sequencing Primer
(F):5'- GCACCCTCCTCTCTGCACAG -3'
(R):5'- TCCCAGCGGCAGATGTTG -3'
Posted On2016-05-10