Mutagenetix > Incidental Mutation

Incidental Mutation 'R0423:Espl1'

38609

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

038625-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0423 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 102303986 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 509 (L509*)

Ref Sequence

ENSEMBL: ENSMUSP00000155304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]

AlphaFold

P60330

Predicted Effect

probably null
Transcript: ENSMUST00000064924
AA Change: L509*

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: L509*

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000229050
AA Change: L509*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230120

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.9%
20x: 91.9%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007K13Rik	T	C	2: 28,466,024		probably benign	Het
4930432E11Rik	A	T	7: 29,562,400		noncoding transcript	Het
A630001G21Rik	A	G	1: 85,726,466	I50T	probably benign	Het
Abhd12	T	C	2: 150,838,392	T264A	possibly damaging	Het
Acsm3	T	C	7: 119,777,159	Y370H	probably damaging	Het
Ank2	G	T	3: 126,929,860	Y3789*	probably null	Het
Anxa4	C	T	6: 86,760,737	A1T	probably damaging	Het
Apba1	T	A	19: 23,944,998	V810D	probably damaging	Het
Bank1	A	G	3: 136,284,017	I104T	possibly damaging	Het
Birc6	T	C	17: 74,696,297	Y4721H	probably damaging	Het
Bmpr2	A	G	1: 59,868,510	T921A	probably benign	Het
Ccdc102a	A	C	8: 94,905,926		probably benign	Het
Ccdc141	C	A	2: 77,039,450	D904Y	probably damaging	Het
Ccdc96	A	G	5: 36,485,247	K199R	probably benign	Het
Cdh10	G	A	15: 18,986,879	V399I	probably benign	Het
Cenpk	A	G	13: 104,234,225	T85A	probably benign	Het
Col6a2	A	C	10: 76,614,917	V60G	possibly damaging	Het
Cops7b	A	G	1: 86,599,031	D119G	probably benign	Het
Cstf2t	A	G	19: 31,084,276	E404G	possibly damaging	Het
Ctnna2	A	T	6: 77,653,069	V134E	probably damaging	Het
Cwh43	A	C	5: 73,416,742	M250L	probably benign	Het
D17Wsu92e	A	C	17: 27,786,233	Y117D	probably damaging	Het
Daam2	T	A	17: 49,469,421	K813*	probably null	Het
Dhcr24	G	A	4: 106,586,536		probably benign	Het
Dnah8	G	T	17: 30,701,981	R1182L	probably benign	Het
Doc2a	C	T	7: 126,848,658	P25S	probably damaging	Het
Dst	A	G	1: 34,278,035	S6823G	possibly damaging	Het
Fbxw19	C	T	9: 109,486,066	V143I	probably benign	Het
Fbxw5	A	G	2: 25,504,526	T171A	possibly damaging	Het
Gfra2	C	T	14: 70,896,081	T117M	probably damaging	Het
Gm454	T	A	5: 138,204,141		noncoding transcript	Het
Kcnq4	A	G	4: 120,717,508	S120P	probably damaging	Het
Krt84	A	T	15: 101,528,720	L336Q	probably damaging	Het
Lilra6	T	A	7: 3,914,775		probably benign	Het
Mbnl2	G	A	14: 120,325,324	R29H	probably damaging	Het
Mcm3ap	G	A	10: 76,502,705	G1389D	probably benign	Het
Mettl13	A	T	1: 162,544,385	I305N	probably damaging	Het
Muc6	A	G	7: 141,652,283	S30P	probably benign	Het
Myh7	T	A	14: 54,979,189	Q1237L	probably benign	Het
Myo9a	T	G	9: 59,895,336	D2035E	probably damaging	Het
Nat10	A	G	2: 103,748,227	S211P	probably damaging	Het
Ntm	T	C	9: 29,179,099	Y108C	probably damaging	Het
Olfr292	T	C	7: 86,695,226	Y257H	possibly damaging	Het
Olfr843	A	T	9: 19,248,952	L149*	probably null	Het
Pcdhb16	A	G	18: 37,480,369	D794G	probably benign	Het
Phlpp1	A	G	1: 106,339,615	T753A	probably benign	Het
Pnldc1	T	C	17: 12,890,076	Q511R	possibly damaging	Het
Ppip5k2	A	G	1: 97,761,427	S38P	possibly damaging	Het
Pygb	A	G	2: 150,823,984	K593E	probably benign	Het
Rangap1	A	T	15: 81,705,463	F564I	probably damaging	Het
Rictor	A	T	15: 6,773,900	I498F	possibly damaging	Het
Rnase12	A	T	14: 51,057,156	V22D	probably benign	Het
Rpl7l1	T	A	17: 46,780,398	M93L	probably benign	Het
Smg1	T	C	7: 118,176,880	R1396G	possibly damaging	Het
Snx19	C	A	9: 30,435,837	T692N	probably damaging	Het
Spag6	A	G	2: 18,710,593	D61G	probably benign	Het
Spen	T	A	4: 141,479,336	N660I	unknown	Het
Sptan1	T	G	2: 30,028,672	C2246G	probably null	Het
Svopl	A	G	6: 38,036,707		probably benign	Het
Taf2	A	T	15: 55,064,682	N108K	probably benign	Het
Thbs4	T	C	13: 92,756,571	D703G	probably damaging	Het
Tle6	G	T	10: 81,598,623	N47K	possibly damaging	Het
Usp48	G	T	4: 137,616,411	V452L	probably benign	Het
Ust	A	T	10: 8,298,148	S198T	probably damaging	Het
Wnk2	T	A	13: 49,095,418	M386L	possibly damaging	Het
Ywhaq	T	C	12: 21,391,381		probably benign	Het
Zfp11	C	T	5: 129,658,238	G53E	possibly damaging	Het
Zfp316	A	G	5: 143,253,238	S1009P	probably damaging	Het
Zfp963	A	G	8: 69,744,506	Y29H	probably damaging	Het
Zmym4	A	G	4: 126,882,319		probably benign	Het
Zranb3	A	G	1: 128,091,870	I45T	probably damaging	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCATTTCGGTCACAACCAGACAG -3'
(R):5'- TGGGCAAAATGATGGTCCTCCAC -3'

Sequencing Primer
(F):5'- AGTTAGAACAGGTCCTTCAGC -3'
(R):5'- ATGATGGTCCTCCACCCCTC -3'

Posted On

2013-05-23