Incidental Mutation 'R0423:Espl1'
ID 38609
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Name extra spindle pole bodies 1, separase
Synonyms ESP1, SSE, separase, PRCE, Cerp, PRCE
MMRRC Submission 038625-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0423 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 102204701-102232792 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 102212421 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 509 (L509*)
Ref Sequence ENSEMBL: ENSMUSP00000155304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]
AlphaFold P60330
Predicted Effect probably null
Transcript: ENSMUST00000064924
AA Change: L509*
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: L509*

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000229050
AA Change: L509*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230120
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,261,825 (GRCm39) noncoding transcript Het
A630001G21Rik A G 1: 85,654,187 (GRCm39) I50T probably benign Het
Abhd12 T C 2: 150,680,312 (GRCm39) T264A possibly damaging Het
Acsm3 T C 7: 119,376,382 (GRCm39) Y370H probably damaging Het
Ank2 G T 3: 126,723,509 (GRCm39) Y3789* probably null Het
Anxa4 C T 6: 86,737,719 (GRCm39) A1T probably damaging Het
Apba1 T A 19: 23,922,362 (GRCm39) V810D probably damaging Het
Bank1 A G 3: 135,989,778 (GRCm39) I104T possibly damaging Het
Birc6 T C 17: 75,003,292 (GRCm39) Y4721H probably damaging Het
Bmpr2 A G 1: 59,907,669 (GRCm39) T921A probably benign Het
Ccdc102a A C 8: 95,632,554 (GRCm39) probably benign Het
Ccdc141 C A 2: 76,869,794 (GRCm39) D904Y probably damaging Het
Ccdc96 A G 5: 36,642,591 (GRCm39) K199R probably benign Het
Cdh10 G A 15: 18,986,965 (GRCm39) V399I probably benign Het
Cenpk A G 13: 104,370,733 (GRCm39) T85A probably benign Het
Col6a2 A C 10: 76,450,751 (GRCm39) V60G possibly damaging Het
Cops7b A G 1: 86,526,753 (GRCm39) D119G probably benign Het
Cstf2t A G 19: 31,061,676 (GRCm39) E404G possibly damaging Het
Ctnna2 A T 6: 77,630,052 (GRCm39) V134E probably damaging Het
Cwh43 A C 5: 73,574,085 (GRCm39) M250L probably benign Het
Daam2 T A 17: 49,776,449 (GRCm39) K813* probably null Het
Dhcr24 G A 4: 106,443,733 (GRCm39) probably benign Het
Dnah8 G T 17: 30,920,955 (GRCm39) R1182L probably benign Het
Doc2a C T 7: 126,447,830 (GRCm39) P25S probably damaging Het
Dst A G 1: 34,317,116 (GRCm39) S6823G possibly damaging Het
Fbxw19 C T 9: 109,315,134 (GRCm39) V143I probably benign Het
Fbxw5 A G 2: 25,394,538 (GRCm39) T171A possibly damaging Het
Gfra2 C T 14: 71,133,521 (GRCm39) T117M probably damaging Het
Gm454 T A 5: 138,202,403 (GRCm39) noncoding transcript Het
Ilrun A C 17: 28,005,207 (GRCm39) Y117D probably damaging Het
Kcnq4 A G 4: 120,574,705 (GRCm39) S120P probably damaging Het
Krt84 A T 15: 101,437,155 (GRCm39) L336Q probably damaging Het
Lilra6 T A 7: 3,917,774 (GRCm39) probably benign Het
Mbnl2 G A 14: 120,562,736 (GRCm39) R29H probably damaging Het
Mcm3ap G A 10: 76,338,539 (GRCm39) G1389D probably benign Het
Mettl13 A T 1: 162,371,954 (GRCm39) I305N probably damaging Het
Muc6 A G 7: 141,238,548 (GRCm39) S30P probably benign Het
Myh7 T A 14: 55,216,646 (GRCm39) Q1237L probably benign Het
Myo9a T G 9: 59,802,619 (GRCm39) D2035E probably damaging Het
Nat10 A G 2: 103,578,572 (GRCm39) S211P probably damaging Het
Ntm T C 9: 29,090,395 (GRCm39) Y108C probably damaging Het
Or14c39 T C 7: 86,344,434 (GRCm39) Y257H possibly damaging Het
Or7g25 A T 9: 19,160,248 (GRCm39) L149* probably null Het
Pcdhb16 A G 18: 37,613,422 (GRCm39) D794G probably benign Het
Phlpp1 A G 1: 106,267,345 (GRCm39) T753A probably benign Het
Pierce1 T C 2: 28,356,036 (GRCm39) probably benign Het
Pnldc1 T C 17: 13,108,963 (GRCm39) Q511R possibly damaging Het
Ppip5k2 A G 1: 97,689,152 (GRCm39) S38P possibly damaging Het
Pygb A G 2: 150,665,904 (GRCm39) K593E probably benign Het
Rangap1 A T 15: 81,589,664 (GRCm39) F564I probably damaging Het
Rictor A T 15: 6,803,381 (GRCm39) I498F possibly damaging Het
Rnase12 A T 14: 51,294,613 (GRCm39) V22D probably benign Het
Rpl7l1 T A 17: 47,091,324 (GRCm39) M93L probably benign Het
Smg1 T C 7: 117,776,103 (GRCm39) R1396G possibly damaging Het
Snx19 C A 9: 30,347,133 (GRCm39) T692N probably damaging Het
Spag6 A G 2: 18,715,404 (GRCm39) D61G probably benign Het
Spen T A 4: 141,206,647 (GRCm39) N660I unknown Het
Sptan1 T G 2: 29,918,684 (GRCm39) C2246G probably null Het
Svopl A G 6: 38,013,642 (GRCm39) probably benign Het
Taf2 A T 15: 54,928,078 (GRCm39) N108K probably benign Het
Thbs4 T C 13: 92,893,079 (GRCm39) D703G probably damaging Het
Tle6 G T 10: 81,434,457 (GRCm39) N47K possibly damaging Het
Usp48 G T 4: 137,343,722 (GRCm39) V452L probably benign Het
Ust A T 10: 8,173,912 (GRCm39) S198T probably damaging Het
Wnk2 T A 13: 49,248,894 (GRCm39) M386L possibly damaging Het
Ywhaq T C 12: 21,441,382 (GRCm39) probably benign Het
Zfp11 C T 5: 129,735,302 (GRCm39) G53E possibly damaging Het
Zfp316 A G 5: 143,238,993 (GRCm39) S1009P probably damaging Het
Zfp963 A G 8: 70,197,156 (GRCm39) Y29H probably damaging Het
Zmym4 A G 4: 126,776,112 (GRCm39) probably benign Het
Zranb3 A G 1: 128,019,607 (GRCm39) I45T probably damaging Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102,208,248 (GRCm39) missense probably damaging 1.00
IGL00839:Espl1 APN 15 102,228,982 (GRCm39) unclassified probably benign
IGL00919:Espl1 APN 15 102,207,064 (GRCm39) missense probably benign 0.03
IGL01125:Espl1 APN 15 102,231,373 (GRCm39) missense probably damaging 1.00
IGL01366:Espl1 APN 15 102,228,271 (GRCm39) missense probably benign 0.00
IGL01488:Espl1 APN 15 102,207,174 (GRCm39) missense probably benign
IGL01554:Espl1 APN 15 102,221,660 (GRCm39) missense probably damaging 1.00
IGL01810:Espl1 APN 15 102,206,640 (GRCm39) missense probably benign
IGL01959:Espl1 APN 15 102,214,097 (GRCm39) splice site probably benign
IGL02267:Espl1 APN 15 102,224,099 (GRCm39) missense probably benign 0.01
IGL02452:Espl1 APN 15 102,208,274 (GRCm39) missense probably damaging 1.00
IGL02469:Espl1 APN 15 102,222,460 (GRCm39) missense probably damaging 1.00
IGL02500:Espl1 APN 15 102,224,235 (GRCm39) missense probably benign
IGL02630:Espl1 APN 15 102,205,253 (GRCm39) missense probably benign 0.11
IGL02687:Espl1 APN 15 102,221,613 (GRCm39) splice site probably benign
IGL02868:Espl1 APN 15 102,222,425 (GRCm39) nonsense probably null
IGL02926:Espl1 APN 15 102,208,290 (GRCm39) missense probably damaging 0.99
R0019:Espl1 UTSW 15 102,214,754 (GRCm39) missense probably null 0.01
R0129:Espl1 UTSW 15 102,225,083 (GRCm39) missense probably benign 0.00
R0184:Espl1 UTSW 15 102,207,651 (GRCm39) missense probably benign 0.01
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0267:Espl1 UTSW 15 102,221,452 (GRCm39) missense possibly damaging 0.89
R0587:Espl1 UTSW 15 102,212,382 (GRCm39) splice site probably benign
R0726:Espl1 UTSW 15 102,231,033 (GRCm39) missense probably benign
R1186:Espl1 UTSW 15 102,212,474 (GRCm39) missense probably benign 0.05
R1282:Espl1 UTSW 15 102,223,826 (GRCm39) missense probably benign 0.00
R1428:Espl1 UTSW 15 102,214,120 (GRCm39) missense probably benign 0.06
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1473:Espl1 UTSW 15 102,228,878 (GRCm39) missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102,206,802 (GRCm39) missense probably damaging 0.98
R1639:Espl1 UTSW 15 102,229,149 (GRCm39) missense probably damaging 1.00
R1725:Espl1 UTSW 15 102,221,656 (GRCm39) missense probably benign 0.08
R1748:Espl1 UTSW 15 102,206,964 (GRCm39) missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102,207,448 (GRCm39) missense probably benign
R1938:Espl1 UTSW 15 102,213,477 (GRCm39) missense probably benign 0.00
R1954:Espl1 UTSW 15 102,206,823 (GRCm39) missense probably damaging 1.00
R2009:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2014:Espl1 UTSW 15 102,231,149 (GRCm39) nonsense probably null
R2067:Espl1 UTSW 15 102,207,525 (GRCm39) missense probably damaging 0.96
R2084:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R2164:Espl1 UTSW 15 102,228,023 (GRCm39) missense probably damaging 1.00
R2204:Espl1 UTSW 15 102,214,340 (GRCm39) missense probably damaging 1.00
R2220:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2237:Espl1 UTSW 15 102,224,004 (GRCm39) missense probably damaging 0.98
R2314:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3107:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3108:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3114:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3616:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3733:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3958:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3959:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3960:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4062:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4063:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4064:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4165:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4166:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4349:Espl1 UTSW 15 102,228,039 (GRCm39) missense probably benign 0.26
R4373:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4376:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4377:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4516:Espl1 UTSW 15 102,231,671 (GRCm39) missense probably benign 0.00
R4595:Espl1 UTSW 15 102,207,159 (GRCm39) missense probably benign 0.01
R4884:Espl1 UTSW 15 102,232,505 (GRCm39) missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102,230,758 (GRCm39) critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102,223,676 (GRCm39) missense probably damaging 0.98
R4931:Espl1 UTSW 15 102,214,165 (GRCm39) missense probably benign 0.02
R4936:Espl1 UTSW 15 102,213,372 (GRCm39) missense probably damaging 1.00
R5000:Espl1 UTSW 15 102,206,986 (GRCm39) missense probably damaging 1.00
R5220:Espl1 UTSW 15 102,207,012 (GRCm39) missense probably benign 0.03
R5329:Espl1 UTSW 15 102,220,953 (GRCm39) missense probably damaging 0.97
R5501:Espl1 UTSW 15 102,225,565 (GRCm39) missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102,232,465 (GRCm39) missense probably damaging 1.00
R5848:Espl1 UTSW 15 102,231,011 (GRCm39) missense probably benign 0.03
R5906:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R5978:Espl1 UTSW 15 102,224,209 (GRCm39) missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102,208,323 (GRCm39) missense probably damaging 0.99
R6313:Espl1 UTSW 15 102,224,247 (GRCm39) missense probably benign 0.00
R6414:Espl1 UTSW 15 102,223,995 (GRCm39) missense probably damaging 0.96
R6484:Espl1 UTSW 15 102,231,935 (GRCm39) missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102,207,660 (GRCm39) missense probably benign
R6928:Espl1 UTSW 15 102,207,342 (GRCm39) missense probably benign 0.28
R6995:Espl1 UTSW 15 102,212,535 (GRCm39) missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102,225,328 (GRCm39) critical splice donor site probably null
R7062:Espl1 UTSW 15 102,207,331 (GRCm39) missense probably benign 0.00
R7135:Espl1 UTSW 15 102,227,959 (GRCm39) nonsense probably null
R7154:Espl1 UTSW 15 102,232,484 (GRCm39) missense probably damaging 1.00
R7164:Espl1 UTSW 15 102,221,638 (GRCm39) missense probably damaging 1.00
R7522:Espl1 UTSW 15 102,213,486 (GRCm39) missense probably damaging 1.00
R7848:Espl1 UTSW 15 102,224,961 (GRCm39) missense probably damaging 1.00
R7894:Espl1 UTSW 15 102,212,460 (GRCm39) missense probably damaging 1.00
R8275:Espl1 UTSW 15 102,211,188 (GRCm39) splice site probably benign
R8752:Espl1 UTSW 15 102,214,759 (GRCm39) missense probably damaging 1.00
R9160:Espl1 UTSW 15 102,206,953 (GRCm39) missense probably damaging 1.00
R9310:Espl1 UTSW 15 102,205,285 (GRCm39) critical splice donor site probably null
R9385:Espl1 UTSW 15 102,207,185 (GRCm39) missense probably damaging 0.99
R9532:Espl1 UTSW 15 102,228,260 (GRCm39) nonsense probably null
R9563:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9565:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9723:Espl1 UTSW 15 102,229,170 (GRCm39) missense probably benign 0.43
X0062:Espl1 UTSW 15 102,206,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATTTCGGTCACAACCAGACAG -3'
(R):5'- TGGGCAAAATGATGGTCCTCCAC -3'

Sequencing Primer
(F):5'- AGTTAGAACAGGTCCTTCAGC -3'
(R):5'- ATGATGGTCCTCCACCCCTC -3'
Posted On 2013-05-23