Mutagenetix > Incidental Mutations

Incidental Mutation 'R4990:Atg16l1'

386097

Institutional Source

Beutler Lab

Gene Symbol

Atg16l1

Ensembl Gene

ENSMUSG00000026289

Gene Name

autophagy related 16-like 1 (S. cerevisiae)

Synonyms

1500009K01Rik, APG16L, WDR30

MMRRC Submission

042584-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4990 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87755870-87792428 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87789369 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 471 (K471R)

Ref Sequence

ENSEMBL: ENSMUSP00000108811 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027512] [ENSMUST00000113186] [ENSMUST00000113190]

Predicted Effect

probably benign
Transcript: ENSMUST00000027512
AA Change: K490R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000027512
Gene: ENSMUSG00000026289
AA Change: K490R

Domain	Start	End	E-Value	Type
Pfam:ATG16	13	207	1.3e-63	PFAM
low complexity region	237	246	N/A	INTRINSIC
WD40	311	350	7.05e-9	SMART
WD40	355	394	7.28e-2	SMART
WD40	397	436	1.07e-8	SMART
WD40	439	475	3.7e0	SMART
WD40	478	516	5.35e-1	SMART
WD40	519	562	1.2e-2	SMART
WD40	565	605	6.89e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113186
AA Change: K471R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000108811
Gene: ENSMUSG00000026289
AA Change: K471R

Domain	Start	End	E-Value	Type
Pfam:ATG16	13	207	3.7e-64	PFAM
low complexity region	237	246	N/A	INTRINSIC
low complexity region	257	271	N/A	INTRINSIC
WD40	292	331	7.05e-9	SMART
WD40	336	375	7.28e-2	SMART
WD40	378	417	1.07e-8	SMART
WD40	420	456	3.7e0	SMART
WD40	459	497	5.35e-1	SMART
WD40	500	543	1.2e-2	SMART
WD40	546	586	6.89e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113190
AA Change: K506R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000108815
Gene: ENSMUSG00000026289
AA Change: K506R

Domain	Start	End	E-Value	Type
Pfam:ATG16	16	206	6.5e-49	PFAM
low complexity region	237	246	N/A	INTRINSIC
low complexity region	295	306	N/A	INTRINSIC
WD40	327	366	7.05e-9	SMART
WD40	371	410	7.28e-2	SMART
WD40	413	452	1.07e-8	SMART
WD40	455	491	3.7e0	SMART
WD40	494	532	5.35e-1	SMART
WD40	535	578	1.2e-2	SMART
WD40	581	621	6.89e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127884

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137638

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151037

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158656

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large protein complex that is necessary for autophagy, the major process by which intracellular components are targeted to lysosomes for degradation. Defects in this gene are a cause of susceptibility to inflammatory bowel disease type 10 (IBD10). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Null homozygotes have a cellular defect in autophagy that results in lethality during the neonatal starvation period. Mice homozygous for hypomorphic alleles have Paneth cells with aberrant, disorganized granules similar to those found in patients with Crohn's disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,294,939	I1135V	possibly damaging	Het
Abca14	G	A	7: 120,312,165	R1324K	probably benign	Het
Amer3	A	C	1: 34,588,741	D687A	probably benign	Het
Aplnr	G	A	2: 85,137,377	V249M	probably damaging	Het
Cacna1b	A	G	2: 24,678,874		probably null	Het
Ccdc152	A	G	15: 3,301,157	I12T	probably benign	Het
Cds1	A	G	5: 101,798,379	Y148C	probably damaging	Het
Cenpe	T	A	3: 135,256,640	L1989Q	probably damaging	Het
Cep295	T	C	9: 15,332,138	Q1674R	probably damaging	Het
D930020B18Rik	C	G	10: 121,654,761	P89A	probably damaging	Het
D930020B18Rik	C	T	10: 121,654,762	P89L	probably damaging	Het
Dock2	T	C	11: 34,695,251	M535V	probably damaging	Het
Dscam	A	G	16: 96,825,515	V398A	probably benign	Het
Elmo1	T	C	13: 20,342,519	F413S	probably damaging	Het
Emb	T	A	13: 117,264,510	N198K	probably damaging	Het
Eno3	A	G	11: 70,658,647	D98G	probably damaging	Het
Fbp1	C	T	13: 62,865,074	V102I	probably benign	Het
Fbxw18	T	C	9: 109,688,393	E414G	probably damaging	Het
Gm16432	A	C	1: 178,098,421	I218L	probably benign	Het
Gm5861	A	T	5: 11,186,414	E138V	probably damaging	Het
Grem2	A	G	1: 174,836,813	C157R	probably damaging	Het
Hnrnpr	A	G	4: 136,329,379	E230G	probably damaging	Het
Hnrnpr	G	A	4: 136,336,298	V239I	probably damaging	Het
Ipo11	A	T	13: 106,860,887	I688K	probably benign	Het
Irx4	G	T	13: 73,265,507	R32L	probably benign	Het
Kcnh7	T	C	2: 62,734,288	N876D	probably benign	Het
Klk1b26	T	A	7: 44,016,249		probably null	Het
Lrp2	G	T	2: 69,481,388	T2582K	probably benign	Het
Lrriq1	A	G	10: 103,200,559	I911T	probably damaging	Het
Megf6	A	G	4: 154,267,226	E1132G	possibly damaging	Het
Mesp1	A	G	7: 79,792,921	Y203H	probably damaging	Het
Ms4a4a	T	C	19: 11,378,837	S29P	probably benign	Het
Nbeal2	A	C	9: 110,634,803	C1174G	probably benign	Het
Neb	C	T	2: 52,255,546	V2989I	probably benign	Het
Nkx2-1	T	C	12: 56,534,939	Y41C	possibly damaging	Het
Nrxn3	T	A	12: 89,260,474	I293N	probably damaging	Het
Nt5e	A	G	9: 88,355,593	N192S	probably benign	Het
Ntng1	A	T	3: 110,135,261		probably null	Het
Olfr1215	A	T	2: 89,001,472	I272K	probably damaging	Het
Olfr1229	A	T	2: 89,283,327		probably null	Het
Olfr411	A	G	11: 74,347,197	I129T	probably damaging	Het
Olfr45	G	A	7: 140,691,447	E181K	probably damaging	Het
Panx1	A	G	9: 15,010,217	Y121H	probably damaging	Het
Pcsk4	A	G	10: 80,325,381	I233T	possibly damaging	Het
Pgm3	T	A	9: 86,558,412	I409F	probably damaging	Het
Plg	T	C	17: 12,411,510	Y645H	probably benign	Het
Pon3	T	C	6: 5,221,619	H337R	probably benign	Het
Rasa2	A	G	9: 96,591,989	I162T	probably benign	Het
Ror1	A	G	4: 100,441,964	I845V	probably benign	Het
Rpl4	T	C	9: 64,174,885	V22A	probably benign	Het
Ryr3	G	T	2: 112,635,777	Q4746K	probably damaging	Het
Ryr3	T	C	2: 112,909,973	N531S	probably damaging	Het
Sbno1	A	T	5: 124,400,165	F571I	probably damaging	Het
Scarf1	T	C	11: 75,526,015	V761A	probably benign	Het
Sec22b	T	G	3: 97,921,111		probably null	Het
Slc45a2	A	G	15: 11,001,150	M112V	probably benign	Het
Snai3	G	A	8: 122,456,332	T158M	possibly damaging	Het
Spata31d1a	T	C	13: 59,703,151	N388D	probably benign	Het
Sv2b	T	C	7: 75,117,722	N642S	possibly damaging	Het
Svil	T	A	18: 5,056,810	I561K	probably benign	Het
Trappc11	A	T	8: 47,490,895	D1127E	probably benign	Het
Triobp	C	A	15: 78,967,005	A453D	probably benign	Het
Tubd1	T	C	11: 86,557,839	L295P	probably damaging	Het
Ulk4	C	T	9: 121,192,786	V620I	probably benign	Het
Vmn2r39	A	G	7: 9,023,676	I442T	probably benign	Het
Wwc1	T	C	11: 35,876,566	T413A	probably benign	Het
Zfp131	A	C	13: 119,782,913	V77G	probably damaging	Het
Zfyve26	T	C	12: 79,287,833	D137G	probably damaging	Het

Other mutations in Atg16l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Atg16l1	APN	1	87765397	missense	possibly damaging	0.68
IGL00861:Atg16l1	APN	1	87774838	missense	probably damaging	1.00
IGL01065:Atg16l1	APN	1	87785931	missense	probably damaging	0.99
IGL01068:Atg16l1	APN	1	87774824	missense	probably damaging	1.00
IGL01140:Atg16l1	APN	1	87774853	missense	probably benign	0.03
R0023:Atg16l1	UTSW	1	87789465	missense	probably benign	0.00
R0023:Atg16l1	UTSW	1	87789465	missense	probably benign	0.00
R0650:Atg16l1	UTSW	1	87781699	missense	possibly damaging	0.93
R0655:Atg16l1	UTSW	1	87766829	missense	probably damaging	1.00
R1421:Atg16l1	UTSW	1	87786358	splice site	probably benign
R1549:Atg16l1	UTSW	1	87774188	missense	probably benign
R2202:Atg16l1	UTSW	1	87767015	missense	probably benign	0.03
R2204:Atg16l1	UTSW	1	87767015	missense	probably benign	0.03
R3689:Atg16l1	UTSW	1	87785904	missense	probably damaging	1.00
R4012:Atg16l1	UTSW	1	87766907	missense	probably damaging	1.00
R4391:Atg16l1	UTSW	1	87760120	missense	probably damaging	0.97
R4839:Atg16l1	UTSW	1	87766174	missense	probably damaging	0.99
R4935:Atg16l1	UTSW	1	87767042	missense	possibly damaging	0.69
R4980:Atg16l1	UTSW	1	87766831	missense	possibly damaging	0.89
R5011:Atg16l1	UTSW	1	87774180	nonsense	probably null
R5457:Atg16l1	UTSW	1	87775091	missense	probably damaging	0.96
R5897:Atg16l1	UTSW	1	87785997	critical splice donor site	probably null
R6289:Atg16l1	UTSW	1	87756215	missense	probably damaging	0.99
R6437:Atg16l1	UTSW	1	87790648	missense	probably damaging	1.00
R6727:Atg16l1	UTSW	1	87774854	missense	possibly damaging	0.68
R6923:Atg16l1	UTSW	1	87774356	splice site	probably null
R7423:Atg16l1	UTSW	1	87786301	missense	probably damaging	1.00
R7475:Atg16l1	UTSW	1	87760083	missense	possibly damaging	0.89
R8493:Atg16l1	UTSW	1	87778982	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATAATAGGCTAGGGACATAGTTCC -3'
(R):5'- GAGCCGCATTTGAATCCAG -3'

Sequencing Primer
(F):5'- GGACATAGTTCCTGCCCCTTGAAG -3'
(R):5'- GCATTTGAATCCAGGCGCAC -3'

Posted On

2016-05-10