Incidental Mutation 'R4990:Klk1b26'
ID386123
Institutional Source Beutler Lab
Gene Symbol Klk1b26
Ensembl Gene ENSMUSG00000053719
Gene Namekallikrein 1-related petidase b26
SynonymsEGF-BP type B, Egfbp2, PRECE-2, Klk26, mGK-26
MMRRC Submission 042584-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R4990 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44012168-44016968 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 44016249 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048945]
Predicted Effect probably null
Transcript: ENSMUST00000048945
SMART Domains Protein: ENSMUSP00000047488
Gene: ENSMUSG00000053719

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 2.29e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205780
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of the peptidase S1 family of serine proteases. The kallikrein genes are present in a large gene cluster on chromosome 7. The encoded preproprotein is proteolytically processed to generate a mature protein product. Expression of this gene in the submandibular gland is sexually dimorphic likely due to both transcriptional and post-transcriptional regulation. This gene is thought to be distinct from the Egfbp2 gene (Gene ID: 13647), with which it shares 98% identity (PMIDs: 1959648, 9685728), however, it is not clear if both genes are present in all strains of mice. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,294,939 I1135V possibly damaging Het
Abca14 G A 7: 120,312,165 R1324K probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Aplnr G A 2: 85,137,377 V249M probably damaging Het
Atg16l1 A G 1: 87,789,369 K471R probably benign Het
Cacna1b A G 2: 24,678,874 probably null Het
Ccdc152 A G 15: 3,301,157 I12T probably benign Het
Cds1 A G 5: 101,798,379 Y148C probably damaging Het
Cenpe T A 3: 135,256,640 L1989Q probably damaging Het
Cep295 T C 9: 15,332,138 Q1674R probably damaging Het
D930020B18Rik C G 10: 121,654,761 P89A probably damaging Het
D930020B18Rik C T 10: 121,654,762 P89L probably damaging Het
Dock2 T C 11: 34,695,251 M535V probably damaging Het
Dscam A G 16: 96,825,515 V398A probably benign Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Emb T A 13: 117,264,510 N198K probably damaging Het
Eno3 A G 11: 70,658,647 D98G probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Fbxw18 T C 9: 109,688,393 E414G probably damaging Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm5861 A T 5: 11,186,414 E138V probably damaging Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Hnrnpr A G 4: 136,329,379 E230G probably damaging Het
Hnrnpr G A 4: 136,336,298 V239I probably damaging Het
Ipo11 A T 13: 106,860,887 I688K probably benign Het
Irx4 G T 13: 73,265,507 R32L probably benign Het
Kcnh7 T C 2: 62,734,288 N876D probably benign Het
Lrp2 G T 2: 69,481,388 T2582K probably benign Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Megf6 A G 4: 154,267,226 E1132G possibly damaging Het
Mesp1 A G 7: 79,792,921 Y203H probably damaging Het
Ms4a4a T C 19: 11,378,837 S29P probably benign Het
Nbeal2 A C 9: 110,634,803 C1174G probably benign Het
Neb C T 2: 52,255,546 V2989I probably benign Het
Nkx2-1 T C 12: 56,534,939 Y41C possibly damaging Het
Nrxn3 T A 12: 89,260,474 I293N probably damaging Het
Nt5e A G 9: 88,355,593 N192S probably benign Het
Ntng1 A T 3: 110,135,261 probably null Het
Olfr1215 A T 2: 89,001,472 I272K probably damaging Het
Olfr1229 A T 2: 89,283,327 probably null Het
Olfr411 A G 11: 74,347,197 I129T probably damaging Het
Olfr45 G A 7: 140,691,447 E181K probably damaging Het
Panx1 A G 9: 15,010,217 Y121H probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Pgm3 T A 9: 86,558,412 I409F probably damaging Het
Plg T C 17: 12,411,510 Y645H probably benign Het
Pon3 T C 6: 5,221,619 H337R probably benign Het
Rasa2 A G 9: 96,591,989 I162T probably benign Het
Ror1 A G 4: 100,441,964 I845V probably benign Het
Rpl4 T C 9: 64,174,885 V22A probably benign Het
Ryr3 G T 2: 112,635,777 Q4746K probably damaging Het
Ryr3 T C 2: 112,909,973 N531S probably damaging Het
Sbno1 A T 5: 124,400,165 F571I probably damaging Het
Scarf1 T C 11: 75,526,015 V761A probably benign Het
Sec22b T G 3: 97,921,111 probably null Het
Slc45a2 A G 15: 11,001,150 M112V probably benign Het
Snai3 G A 8: 122,456,332 T158M possibly damaging Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Trappc11 A T 8: 47,490,895 D1127E probably benign Het
Triobp C A 15: 78,967,005 A453D probably benign Het
Tubd1 T C 11: 86,557,839 L295P probably damaging Het
Ulk4 C T 9: 121,192,786 V620I probably benign Het
Vmn2r39 A G 7: 9,023,676 I442T probably benign Het
Wwc1 T C 11: 35,876,566 T413A probably benign Het
Zfp131 A C 13: 119,782,913 V77G probably damaging Het
Zfyve26 T C 12: 79,287,833 D137G probably damaging Het
Other mutations in Klk1b26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Klk1b26 APN 7 44016885 missense probably benign 0.00
IGL02179:Klk1b26 APN 7 44016312 missense probably benign
IGL03190:Klk1b26 APN 7 44012727 missense possibly damaging 0.76
R0391:Klk1b26 UTSW 7 44012727 missense probably damaging 1.00
R0483:Klk1b26 UTSW 7 44016348 missense probably benign 0.15
R1499:Klk1b26 UTSW 7 44016386 missense probably benign 0.22
R1549:Klk1b26 UTSW 7 44016402 splice site probably benign
R1991:Klk1b26 UTSW 7 44016900 missense probably damaging 0.99
R2103:Klk1b26 UTSW 7 44016900 missense probably damaging 0.99
R2998:Klk1b26 UTSW 7 44016798 missense probably benign 0.26
R3414:Klk1b26 UTSW 7 44016873 missense probably benign
R4991:Klk1b26 UTSW 7 44016249 splice site probably null
R5527:Klk1b26 UTSW 7 44012763 missense probably benign 0.00
R5796:Klk1b26 UTSW 7 44016328 missense probably damaging 1.00
R6816:Klk1b26 UTSW 7 44016868 missense probably benign 0.00
R6938:Klk1b26 UTSW 7 44016294 missense probably benign 0.00
R7197:Klk1b26 UTSW 7 44016397 critical splice donor site probably null
R7243:Klk1b26 UTSW 7 44016267 missense not run
R7243:Klk1b26 UTSW 7 44016913 missense probably damaging 1.00
R7253:Klk1b26 UTSW 7 44014789 missense possibly damaging 0.66
R7423:Klk1b26 UTSW 7 44014769 missense probably damaging 0.99
R8270:Klk1b26 UTSW 7 44016120 missense probably benign 0.08
R8342:Klk1b26 UTSW 7 44016084 missense probably damaging 0.98
Z1088:Klk1b26 UTSW 7 44015996 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGCAATGACCTGATGCTG -3'
(R):5'- CTTCACCTCACTGCAGAGAG -3'

Sequencing Primer
(F):5'- CAGATGTTGTGAAGCCCATCG -3'
(R):5'- AGGGTCTGTCTTACCGCACAAG -3'
Posted On2016-05-10