Incidental Mutation 'R4990:Rpl4'
ID386134
Institutional Source Beutler Lab
Gene Symbol Rpl4
Ensembl Gene ENSMUSG00000032399
Gene Nameribosomal protein L4
Synonyms
MMRRC Submission 042584-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R4990 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location64173375-64178666 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64174885 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 22 (V22A)
Ref Sequence ENSEMBL: ENSMUSP00000034966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034965] [ENSMUST00000034966] [ENSMUST00000122091] [ENSMUST00000130127] [ENSMUST00000176299] [ENSMUST00000176378] [ENSMUST00000176794] [ENSMUST00000177045]
Predicted Effect probably benign
Transcript: ENSMUST00000034965
SMART Domains Protein: ENSMUSP00000034965
Gene: ENSMUSG00000032398

DomainStartEndE-ValueType
Pfam:SNAPc19 7 101 5.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034966
AA Change: V22A

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034966
Gene: ENSMUSG00000032399
AA Change: V22A

DomainStartEndE-ValueType
Pfam:Ribosomal_L4 22 263 9.7e-47 PFAM
Pfam:Ribos_L4_asso_C 275 349 4e-34 PFAM
low complexity region 352 367 N/A INTRINSIC
low complexity region 375 419 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083895
Predicted Effect probably benign
Transcript: ENSMUST00000122091
SMART Domains Protein: ENSMUSP00000112790
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 38 589 6e-206 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124301
SMART Domains Protein: ENSMUSP00000134966
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
PDB:3IF8|A 3 74 3e-31 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000130127
SMART Domains Protein: ENSMUSP00000116187
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 72 154 8e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151428
Predicted Effect probably benign
Transcript: ENSMUST00000176299
SMART Domains Protein: ENSMUSP00000135585
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 1 471 2.9e-192 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176378
SMART Domains Protein: ENSMUSP00000134782
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
PDB:3IF8|A 3 74 1e-31 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000176794
SMART Domains Protein: ENSMUSP00000134850
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 38 257 8e-67 PFAM
Pfam:DUF2352 254 568 4.4e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177045
SMART Domains Protein: ENSMUSP00000135328
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 19 303 2.2e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217055
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L4E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,294,939 I1135V possibly damaging Het
Abca14 G A 7: 120,312,165 R1324K probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Aplnr G A 2: 85,137,377 V249M probably damaging Het
Atg16l1 A G 1: 87,789,369 K471R probably benign Het
Cacna1b A G 2: 24,678,874 probably null Het
Ccdc152 A G 15: 3,301,157 I12T probably benign Het
Cds1 A G 5: 101,798,379 Y148C probably damaging Het
Cenpe T A 3: 135,256,640 L1989Q probably damaging Het
Cep295 T C 9: 15,332,138 Q1674R probably damaging Het
D930020B18Rik C G 10: 121,654,761 P89A probably damaging Het
D930020B18Rik C T 10: 121,654,762 P89L probably damaging Het
Dock2 T C 11: 34,695,251 M535V probably damaging Het
Dscam A G 16: 96,825,515 V398A probably benign Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Emb T A 13: 117,264,510 N198K probably damaging Het
Eno3 A G 11: 70,658,647 D98G probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Fbxw18 T C 9: 109,688,393 E414G probably damaging Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm5861 A T 5: 11,186,414 E138V probably damaging Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Hnrnpr A G 4: 136,329,379 E230G probably damaging Het
Hnrnpr G A 4: 136,336,298 V239I probably damaging Het
Ipo11 A T 13: 106,860,887 I688K probably benign Het
Irx4 G T 13: 73,265,507 R32L probably benign Het
Kcnh7 T C 2: 62,734,288 N876D probably benign Het
Klk1b26 T A 7: 44,016,249 probably null Het
Lrp2 G T 2: 69,481,388 T2582K probably benign Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Megf6 A G 4: 154,267,226 E1132G possibly damaging Het
Mesp1 A G 7: 79,792,921 Y203H probably damaging Het
Ms4a4a T C 19: 11,378,837 S29P probably benign Het
Nbeal2 A C 9: 110,634,803 C1174G probably benign Het
Neb C T 2: 52,255,546 V2989I probably benign Het
Nkx2-1 T C 12: 56,534,939 Y41C possibly damaging Het
Nrxn3 T A 12: 89,260,474 I293N probably damaging Het
Nt5e A G 9: 88,355,593 N192S probably benign Het
Ntng1 A T 3: 110,135,261 probably null Het
Olfr1215 A T 2: 89,001,472 I272K probably damaging Het
Olfr1229 A T 2: 89,283,327 probably null Het
Olfr411 A G 11: 74,347,197 I129T probably damaging Het
Olfr45 G A 7: 140,691,447 E181K probably damaging Het
Panx1 A G 9: 15,010,217 Y121H probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Pgm3 T A 9: 86,558,412 I409F probably damaging Het
Plg T C 17: 12,411,510 Y645H probably benign Het
Pon3 T C 6: 5,221,619 H337R probably benign Het
Rasa2 A G 9: 96,591,989 I162T probably benign Het
Ror1 A G 4: 100,441,964 I845V probably benign Het
Ryr3 G T 2: 112,635,777 Q4746K probably damaging Het
Ryr3 T C 2: 112,909,973 N531S probably damaging Het
Sbno1 A T 5: 124,400,165 F571I probably damaging Het
Scarf1 T C 11: 75,526,015 V761A probably benign Het
Sec22b T G 3: 97,921,111 probably null Het
Slc45a2 A G 15: 11,001,150 M112V probably benign Het
Snai3 G A 8: 122,456,332 T158M possibly damaging Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Trappc11 A T 8: 47,490,895 D1127E probably benign Het
Triobp C A 15: 78,967,005 A453D probably benign Het
Tubd1 T C 11: 86,557,839 L295P probably damaging Het
Ulk4 C T 9: 121,192,786 V620I probably benign Het
Vmn2r39 A G 7: 9,023,676 I442T probably benign Het
Wwc1 T C 11: 35,876,566 T413A probably benign Het
Zfp131 A C 13: 119,782,913 V77G probably damaging Het
Zfyve26 T C 12: 79,287,833 D137G probably damaging Het
Other mutations in Rpl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Rpl4 APN 9 64174939 missense probably damaging 1.00
IGL02142:Rpl4 APN 9 64176206 missense possibly damaging 0.86
IGL02746:Rpl4 APN 9 64175650 missense probably benign 0.00
IGL03084:Rpl4 APN 9 64178317 unclassified probably benign
IGL03332:Rpl4 APN 9 64176088 unclassified probably benign
R2320:Rpl4 UTSW 9 64175599 missense probably damaging 1.00
R6880:Rpl4 UTSW 9 64177053 missense probably damaging 1.00
R7734:Rpl4 UTSW 9 64177379 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CAGTTAACACCTGCCTTCCTAG -3'
(R):5'- GTTCAGAAACACGGACCAATG -3'

Sequencing Primer
(F):5'- TAGTCCCCAGGGAGTCATATCTG -3'
(R):5'- CGGACCAATGGAATCTCATCATTTAC -3'
Posted On2016-05-10