Mutagenetix > Incidental Mutations

Incidental Mutation 'R4990:Rasa2'

386137

Institutional Source

Beutler Lab

Gene Symbol

Rasa2

Ensembl Gene

ENSMUSG00000032413

Gene Name

RAS p21 protein activator 2

Synonyms

GAP1m, 5430433H21Rik

MMRRC Submission

042584-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.128) question?

Stock #

R4990 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

96539300-96631617 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 96591989 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 162 (I162T)

Ref Sequence

ENSEMBL: ENSMUSP00000034984 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034984] [ENSMUST00000128346]

Predicted Effect

probably benign
Transcript: ENSMUST00000034984
AA Change: I162T

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000034984
Gene: ENSMUSG00000032413
AA Change: I162T

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
C2	38	136	3.78e-16	SMART
C2	171	287	8.48e-19	SMART
RasGAP	300	641	7.05e-140	SMART
PH	604	706	1.98e-17	SMART
BTK	706	742	1.39e-18	SMART
low complexity region	824	838	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000128346

SMART Domains

Protein: ENSMUSP00000115629
Gene: ENSMUSG00000032413

Domain	Start	End	E-Value	Type
C2	3	79	6.86e-5	SMART
C2	114	230	8.48e-19	SMART
RasGAP	243	584	7.05e-140	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,294,939	I1135V	possibly damaging	Het
Abca14	G	A	7: 120,312,165	R1324K	probably benign	Het
Amer3	A	C	1: 34,588,741	D687A	probably benign	Het
Aplnr	G	A	2: 85,137,377	V249M	probably damaging	Het
Atg16l1	A	G	1: 87,789,369	K471R	probably benign	Het
Cacna1b	A	G	2: 24,678,874		probably null	Het
Ccdc152	A	G	15: 3,301,157	I12T	probably benign	Het
Cds1	A	G	5: 101,798,379	Y148C	probably damaging	Het
Cenpe	T	A	3: 135,256,640	L1989Q	probably damaging	Het
Cep295	T	C	9: 15,332,138	Q1674R	probably damaging	Het
D930020B18Rik	C	G	10: 121,654,761	P89A	probably damaging	Het
D930020B18Rik	C	T	10: 121,654,762	P89L	probably damaging	Het
Dock2	T	C	11: 34,695,251	M535V	probably damaging	Het
Dscam	A	G	16: 96,825,515	V398A	probably benign	Het
Elmo1	T	C	13: 20,342,519	F413S	probably damaging	Het
Emb	T	A	13: 117,264,510	N198K	probably damaging	Het
Eno3	A	G	11: 70,658,647	D98G	probably damaging	Het
Fbp1	C	T	13: 62,865,074	V102I	probably benign	Het
Fbxw18	T	C	9: 109,688,393	E414G	probably damaging	Het
Gm16432	A	C	1: 178,098,421	I218L	probably benign	Het
Gm5861	A	T	5: 11,186,414	E138V	probably damaging	Het
Grem2	A	G	1: 174,836,813	C157R	probably damaging	Het
Hnrnpr	A	G	4: 136,329,379	E230G	probably damaging	Het
Hnrnpr	G	A	4: 136,336,298	V239I	probably damaging	Het
Ipo11	A	T	13: 106,860,887	I688K	probably benign	Het
Irx4	G	T	13: 73,265,507	R32L	probably benign	Het
Kcnh7	T	C	2: 62,734,288	N876D	probably benign	Het
Klk1b26	T	A	7: 44,016,249		probably null	Het
Lrp2	G	T	2: 69,481,388	T2582K	probably benign	Het
Lrriq1	A	G	10: 103,200,559	I911T	probably damaging	Het
Megf6	A	G	4: 154,267,226	E1132G	possibly damaging	Het
Mesp1	A	G	7: 79,792,921	Y203H	probably damaging	Het
Ms4a4a	T	C	19: 11,378,837	S29P	probably benign	Het
Nbeal2	A	C	9: 110,634,803	C1174G	probably benign	Het
Neb	C	T	2: 52,255,546	V2989I	probably benign	Het
Nkx2-1	T	C	12: 56,534,939	Y41C	possibly damaging	Het
Nrxn3	T	A	12: 89,260,474	I293N	probably damaging	Het
Nt5e	A	G	9: 88,355,593	N192S	probably benign	Het
Ntng1	A	T	3: 110,135,261		probably null	Het
Olfr1215	A	T	2: 89,001,472	I272K	probably damaging	Het
Olfr1229	A	T	2: 89,283,327		probably null	Het
Olfr411	A	G	11: 74,347,197	I129T	probably damaging	Het
Olfr45	G	A	7: 140,691,447	E181K	probably damaging	Het
Panx1	A	G	9: 15,010,217	Y121H	probably damaging	Het
Pcsk4	A	G	10: 80,325,381	I233T	possibly damaging	Het
Pgm3	T	A	9: 86,558,412	I409F	probably damaging	Het
Plg	T	C	17: 12,411,510	Y645H	probably benign	Het
Pon3	T	C	6: 5,221,619	H337R	probably benign	Het
Ror1	A	G	4: 100,441,964	I845V	probably benign	Het
Rpl4	T	C	9: 64,174,885	V22A	probably benign	Het
Ryr3	G	T	2: 112,635,777	Q4746K	probably damaging	Het
Ryr3	T	C	2: 112,909,973	N531S	probably damaging	Het
Sbno1	A	T	5: 124,400,165	F571I	probably damaging	Het
Scarf1	T	C	11: 75,526,015	V761A	probably benign	Het
Sec22b	T	G	3: 97,921,111		probably null	Het
Slc45a2	A	G	15: 11,001,150	M112V	probably benign	Het
Snai3	G	A	8: 122,456,332	T158M	possibly damaging	Het
Spata31d1a	T	C	13: 59,703,151	N388D	probably benign	Het
Sv2b	T	C	7: 75,117,722	N642S	possibly damaging	Het
Svil	T	A	18: 5,056,810	I561K	probably benign	Het
Trappc11	A	T	8: 47,490,895	D1127E	probably benign	Het
Triobp	C	A	15: 78,967,005	A453D	probably benign	Het
Tubd1	T	C	11: 86,557,839	L295P	probably damaging	Het
Ulk4	C	T	9: 121,192,786	V620I	probably benign	Het
Vmn2r39	A	G	7: 9,023,676	I442T	probably benign	Het
Wwc1	T	C	11: 35,876,566	T413A	probably benign	Het
Zfp131	A	C	13: 119,782,913	V77G	probably damaging	Het
Zfyve26	T	C	12: 79,287,833	D137G	probably damaging	Het

Other mutations in Rasa2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:Rasa2	APN	9	96544860	missense	probably damaging	1.00
IGL00661:Rasa2	APN	9	96577553	splice site	probably benign
IGL00825:Rasa2	APN	9	96570719	missense	probably benign	0.37
IGL01645:Rasa2	APN	9	96582781	nonsense	probably null
IGL02260:Rasa2	APN	9	96544319	missense	probably benign	0.08
IGL02568:Rasa2	APN	9	96580510	missense	probably damaging	1.00
IGL02963:Rasa2	APN	9	96570785	missense	probably damaging	1.00
R0018:Rasa2	UTSW	9	96571963	missense	probably damaging	1.00
R0018:Rasa2	UTSW	9	96571963	missense	probably damaging	1.00
R0144:Rasa2	UTSW	9	96592019	missense	probably damaging	0.99
R0238:Rasa2	UTSW	9	96568407	missense	probably damaging	1.00
R0238:Rasa2	UTSW	9	96568407	missense	probably damaging	1.00
R0295:Rasa2	UTSW	9	96545810	splice site	probably null
R0332:Rasa2	UTSW	9	96606176	missense	probably damaging	1.00
R0348:Rasa2	UTSW	9	96571959	missense	probably damaging	1.00
R0931:Rasa2	UTSW	9	96552404	missense	possibly damaging	0.88
R1067:Rasa2	UTSW	9	96552323	missense	probably damaging	1.00
R1485:Rasa2	UTSW	9	96544348	missense	probably benign	0.00
R1562:Rasa2	UTSW	9	96545750	missense	possibly damaging	0.89
R1698:Rasa2	UTSW	9	96568375	missense	possibly damaging	0.56
R1980:Rasa2	UTSW	9	96570768	missense	probably damaging	0.99
R3055:Rasa2	UTSW	9	96611473	missense	possibly damaging	0.77
R4175:Rasa2	UTSW	9	96560777	missense	probably benign	0.01
R4258:Rasa2	UTSW	9	96557380	intron	probably benign
R4432:Rasa2	UTSW	9	96542407	unclassified	probably benign
R4636:Rasa2	UTSW	9	96544337	missense	probably benign
R4773:Rasa2	UTSW	9	96544417	missense	probably benign
R5177:Rasa2	UTSW	9	96544791	nonsense	probably null
R5462:Rasa2	UTSW	9	96571918	missense	probably damaging	1.00
R5737:Rasa2	UTSW	9	96570665	critical splice donor site	probably null
R5775:Rasa2	UTSW	9	96577468	splice site	probably null
R5866:Rasa2	UTSW	9	96545770	missense	probably benign	0.00
R5938:Rasa2	UTSW	9	96611389	missense	possibly damaging	0.50
R6076:Rasa2	UTSW	9	96545646	missense	probably benign
R6216:Rasa2	UTSW	9	96544304	missense	probably damaging	1.00
R6743:Rasa2	UTSW	9	96611440	missense	probably damaging	1.00
R6982:Rasa2	UTSW	9	96560750	missense	probably damaging	1.00
R7350:Rasa2	UTSW	9	96544355	missense	probably benign	0.16
R7405:Rasa2	UTSW	9	96566027	missense	probably benign	0.09
R7421:Rasa2	UTSW	9	96611447	missense	unknown
R7490:Rasa2	UTSW	9	96566122	missense	possibly damaging	0.48
R7515:Rasa2	UTSW	9	96552300	splice site	probably null
R7547:Rasa2	UTSW	9	96611421	missense	probably damaging	1.00
R7557:Rasa2	UTSW	9	96557425	missense	probably damaging	0.98
R7821:Rasa2	UTSW	9	96580484	splice site	probably null
R7894:Rasa2	UTSW	9	96602727	missense	probably benign	0.13
R8089:Rasa2	UTSW	9	96553124	missense	probably benign	0.00
R8193:Rasa2	UTSW	9	96602738	missense	probably damaging	0.97
RF017:Rasa2	UTSW	9	96631468	small insertion	probably benign
RF029:Rasa2	UTSW	9	96631467	small insertion	probably benign
RF047:Rasa2	UTSW	9	96631467	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGCTGGATTCTCAGTTTGGTAAAG -3'
(R):5'- CATGCATGCACATACATTGGTG -3'

Sequencing Primer
(F):5'- TCTCAGTTTGGTAAAGAAATGATGC -3'
(R):5'- GCACATACATTGGTGATTATTAGCC -3'

Posted On

2016-05-10