Mutagenetix > Incidental Mutations

Incidental Mutation 'R4990:Zfyve26'

386151

Institutional Source

Beutler Lab

Gene Symbol

Zfyve26

Ensembl Gene

ENSMUSG00000066440

Gene Name

zinc finger, FYVE domain containing 26

Synonyms

A630028O16Rik, LOC380767, 9330197E15Rik

MMRRC Submission

042584-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4990 (G1)

Quality Score

172

Status

Not validated

Chromosome

Chromosomal Location

79232346-79296304 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79287833 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 137 (D137G)

Ref Sequence

ENSEMBL: ENSMUSP00000151280 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021547] [ENSMUST00000218377]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021547
AA Change: D137G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440
AA Change: D137G

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
low complexity region	233	244	N/A	INTRINSIC
low complexity region	752	775	N/A	INTRINSIC
low complexity region	778	796	N/A	INTRINSIC
low complexity region	982	1001	N/A	INTRINSIC
low complexity region	1073	1091	N/A	INTRINSIC
low complexity region	1104	1115	N/A	INTRINSIC
low complexity region	1151	1163	N/A	INTRINSIC
low complexity region	1177	1192	N/A	INTRINSIC
low complexity region	1228	1241	N/A	INTRINSIC
low complexity region	1565	1584	N/A	INTRINSIC
low complexity region	1743	1770	N/A	INTRINSIC
FYVE	1794	1863	1.49e-27	SMART
low complexity region	2486	2498	N/A	INTRINSIC
low complexity region	2517	2528	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000218377
AA Change: D137G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218510

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219842

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygoys for a null allele display a late-onset spastic gait disorder with cerebellar ataxia, axon degeneration, and progressive loss of cortical motoneurons and Purkinje cells preceded by accumulation of autofluorescent, electron-dense, membrane-enclosed material in lysosomal structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,294,939	I1135V	possibly damaging	Het
Abca14	G	A	7: 120,312,165	R1324K	probably benign	Het
Amer3	A	C	1: 34,588,741	D687A	probably benign	Het
Aplnr	G	A	2: 85,137,377	V249M	probably damaging	Het
Atg16l1	A	G	1: 87,789,369	K471R	probably benign	Het
Cacna1b	A	G	2: 24,678,874		probably null	Het
Ccdc152	A	G	15: 3,301,157	I12T	probably benign	Het
Cds1	A	G	5: 101,798,379	Y148C	probably damaging	Het
Cenpe	T	A	3: 135,256,640	L1989Q	probably damaging	Het
Cep295	T	C	9: 15,332,138	Q1674R	probably damaging	Het
D930020B18Rik	C	G	10: 121,654,761	P89A	probably damaging	Het
D930020B18Rik	C	T	10: 121,654,762	P89L	probably damaging	Het
Dock2	T	C	11: 34,695,251	M535V	probably damaging	Het
Dscam	A	G	16: 96,825,515	V398A	probably benign	Het
Elmo1	T	C	13: 20,342,519	F413S	probably damaging	Het
Emb	T	A	13: 117,264,510	N198K	probably damaging	Het
Eno3	A	G	11: 70,658,647	D98G	probably damaging	Het
Fbp1	C	T	13: 62,865,074	V102I	probably benign	Het
Fbxw18	T	C	9: 109,688,393	E414G	probably damaging	Het
Gm16432	A	C	1: 178,098,421	I218L	probably benign	Het
Gm5861	A	T	5: 11,186,414	E138V	probably damaging	Het
Grem2	A	G	1: 174,836,813	C157R	probably damaging	Het
Hnrnpr	A	G	4: 136,329,379	E230G	probably damaging	Het
Hnrnpr	G	A	4: 136,336,298	V239I	probably damaging	Het
Ipo11	A	T	13: 106,860,887	I688K	probably benign	Het
Irx4	G	T	13: 73,265,507	R32L	probably benign	Het
Kcnh7	T	C	2: 62,734,288	N876D	probably benign	Het
Klk1b26	T	A	7: 44,016,249		probably null	Het
Lrp2	G	T	2: 69,481,388	T2582K	probably benign	Het
Lrriq1	A	G	10: 103,200,559	I911T	probably damaging	Het
Megf6	A	G	4: 154,267,226	E1132G	possibly damaging	Het
Mesp1	A	G	7: 79,792,921	Y203H	probably damaging	Het
Ms4a4a	T	C	19: 11,378,837	S29P	probably benign	Het
Nbeal2	A	C	9: 110,634,803	C1174G	probably benign	Het
Neb	C	T	2: 52,255,546	V2989I	probably benign	Het
Nkx2-1	T	C	12: 56,534,939	Y41C	possibly damaging	Het
Nrxn3	T	A	12: 89,260,474	I293N	probably damaging	Het
Nt5e	A	G	9: 88,355,593	N192S	probably benign	Het
Ntng1	A	T	3: 110,135,261		probably null	Het
Olfr1215	A	T	2: 89,001,472	I272K	probably damaging	Het
Olfr1229	A	T	2: 89,283,327		probably null	Het
Olfr411	A	G	11: 74,347,197	I129T	probably damaging	Het
Olfr45	G	A	7: 140,691,447	E181K	probably damaging	Het
Panx1	A	G	9: 15,010,217	Y121H	probably damaging	Het
Pcsk4	A	G	10: 80,325,381	I233T	possibly damaging	Het
Pgm3	T	A	9: 86,558,412	I409F	probably damaging	Het
Plg	T	C	17: 12,411,510	Y645H	probably benign	Het
Pon3	T	C	6: 5,221,619	H337R	probably benign	Het
Rasa2	A	G	9: 96,591,989	I162T	probably benign	Het
Ror1	A	G	4: 100,441,964	I845V	probably benign	Het
Rpl4	T	C	9: 64,174,885	V22A	probably benign	Het
Ryr3	G	T	2: 112,635,777	Q4746K	probably damaging	Het
Ryr3	T	C	2: 112,909,973	N531S	probably damaging	Het
Sbno1	A	T	5: 124,400,165	F571I	probably damaging	Het
Scarf1	T	C	11: 75,526,015	V761A	probably benign	Het
Sec22b	T	G	3: 97,921,111		probably null	Het
Slc45a2	A	G	15: 11,001,150	M112V	probably benign	Het
Snai3	G	A	8: 122,456,332	T158M	possibly damaging	Het
Spata31d1a	T	C	13: 59,703,151	N388D	probably benign	Het
Sv2b	T	C	7: 75,117,722	N642S	possibly damaging	Het
Svil	T	A	18: 5,056,810	I561K	probably benign	Het
Trappc11	A	T	8: 47,490,895	D1127E	probably benign	Het
Triobp	C	A	15: 78,967,005	A453D	probably benign	Het
Tubd1	T	C	11: 86,557,839	L295P	probably damaging	Het
Ulk4	C	T	9: 121,192,786	V620I	probably benign	Het
Vmn2r39	A	G	7: 9,023,676	I442T	probably benign	Het
Wwc1	T	C	11: 35,876,566	T413A	probably benign	Het
Zfp131	A	C	13: 119,782,913	V77G	probably damaging	Het

Other mutations in Zfyve26

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Zfyve26	APN	12	79249460	unclassified	probably benign
IGL00940:Zfyve26	APN	12	79280900	missense	probably benign
IGL01148:Zfyve26	APN	12	79260870	missense	probably benign	0.01
IGL01347:Zfyve26	APN	12	79252183	intron	probably null
IGL01472:Zfyve26	APN	12	79276343	missense	probably benign	0.01
IGL01490:Zfyve26	APN	12	79244373	missense	probably damaging	1.00
IGL01516:Zfyve26	APN	12	79287851	missense	probably benign	0.37
IGL01642:Zfyve26	APN	12	79261574	splice site	probably null
IGL01689:Zfyve26	APN	12	79284053	missense	possibly damaging	0.71
IGL01877:Zfyve26	APN	12	79287444	missense	probably damaging	1.00
IGL01997:Zfyve26	APN	12	79244400	missense	probably benign	0.00
IGL02077:Zfyve26	APN	12	79276395	missense	possibly damaging	0.54
IGL02437:Zfyve26	APN	12	79268847	missense	probably benign	0.01
IGL02933:Zfyve26	APN	12	79280080	missense	possibly damaging	0.94
IGL02937:Zfyve26	APN	12	79239020	missense	probably benign	0.08
IGL02982:Zfyve26	APN	12	79263870	missense	probably damaging	0.99
IGL03064:Zfyve26	APN	12	79261791	missense	probably damaging	1.00
IGL03086:Zfyve26	APN	12	79295564	missense	probably damaging	0.96
IGL03146:Zfyve26	APN	12	79284072	nonsense	probably null
IGL02799:Zfyve26	UTSW	12	79273310	missense	probably benign	0.28
R0318:Zfyve26	UTSW	12	79276281	missense	probably damaging	1.00
R0513:Zfyve26	UTSW	12	79244484	missense	probably damaging	1.00
R0582:Zfyve26	UTSW	12	79246222	missense	probably damaging	1.00
R0586:Zfyve26	UTSW	12	79268728	missense	possibly damaging	0.96
R0718:Zfyve26	UTSW	12	79265802	splice site	probably benign
R0738:Zfyve26	UTSW	12	79295534	missense	probably damaging	1.00
R0781:Zfyve26	UTSW	12	79280067	missense	probably damaging	0.99
R0894:Zfyve26	UTSW	12	79273598	missense	possibly damaging	0.80
R1109:Zfyve26	UTSW	12	79272127	missense	probably damaging	1.00
R1110:Zfyve26	UTSW	12	79280067	missense	probably damaging	0.99
R1186:Zfyve26	UTSW	12	79263949	missense	probably damaging	1.00
R1295:Zfyve26	UTSW	12	79274920	missense	probably damaging	1.00
R1430:Zfyve26	UTSW	12	79282817	missense	probably benign	0.07
R1439:Zfyve26	UTSW	12	79252163	missense	probably benign	0.03
R1517:Zfyve26	UTSW	12	79252151	missense	probably damaging	0.98
R1553:Zfyve26	UTSW	12	79287761	missense	probably benign	0.00
R1721:Zfyve26	UTSW	12	79261799	missense	possibly damaging	0.94
R1758:Zfyve26	UTSW	12	79238944	missense	probably damaging	1.00
R1779:Zfyve26	UTSW	12	79278463	missense	probably damaging	1.00
R1785:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R1786:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R1826:Zfyve26	UTSW	12	79269049	missense	probably damaging	1.00
R1833:Zfyve26	UTSW	12	79286258	missense	probably benign	0.36
R1868:Zfyve26	UTSW	12	79261799	missense	possibly damaging	0.94
R1900:Zfyve26	UTSW	12	79264351	missense	probably damaging	1.00
R1928:Zfyve26	UTSW	12	79239970	nonsense	probably null
R1982:Zfyve26	UTSW	12	79255243	missense	possibly damaging	0.55
R2062:Zfyve26	UTSW	12	79284032	splice site	probably null
R2071:Zfyve26	UTSW	12	79287446	missense	possibly damaging	0.95
R2130:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R2132:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R2133:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R2135:Zfyve26	UTSW	12	79246052	missense	possibly damaging	0.80
R2207:Zfyve26	UTSW	12	79246087	missense	probably damaging	0.99
R2280:Zfyve26	UTSW	12	79275040	missense	probably damaging	1.00
R2352:Zfyve26	UTSW	12	79284116	missense	probably damaging	1.00
R2398:Zfyve26	UTSW	12	79282799	splice site	probably null
R3084:Zfyve26	UTSW	12	79265683	splice site	probably benign
R3086:Zfyve26	UTSW	12	79265683	splice site	probably benign
R4626:Zfyve26	UTSW	12	79269070	missense	possibly damaging	0.95
R4727:Zfyve26	UTSW	12	79244396	missense	probably benign	0.16
R4908:Zfyve26	UTSW	12	79249695	intron	probably null
R4926:Zfyve26	UTSW	12	79275011	missense	probably benign
R4999:Zfyve26	UTSW	12	79280385	nonsense	probably null
R5029:Zfyve26	UTSW	12	79286323	missense	probably damaging	0.99
R5070:Zfyve26	UTSW	12	79255361	missense	probably damaging	1.00
R5100:Zfyve26	UTSW	12	79280058	nonsense	probably null
R5252:Zfyve26	UTSW	12	79268982	missense	probably damaging	1.00
R5318:Zfyve26	UTSW	12	79270850	missense	probably benign	0.35
R5509:Zfyve26	UTSW	12	79246521	missense	probably damaging	1.00
R5574:Zfyve26	UTSW	12	79239924	missense	possibly damaging	0.63
R5735:Zfyve26	UTSW	12	79273373	missense	probably damaging	0.96
R5756:Zfyve26	UTSW	12	79264357	missense	probably damaging	1.00
R5773:Zfyve26	UTSW	12	79287737	missense	probably damaging	1.00
R5834:Zfyve26	UTSW	12	79266537	missense	probably benign	0.30
R6075:Zfyve26	UTSW	12	79293854	missense	possibly damaging	0.74
R6184:Zfyve26	UTSW	12	79268727	missense	probably damaging	0.98
R6235:Zfyve26	UTSW	12	79249599	missense	probably damaging	1.00
R6247:Zfyve26	UTSW	12	79282984	missense	probably benign	0.04
R6320:Zfyve26	UTSW	12	79240002	missense	probably damaging	0.97
R6548:Zfyve26	UTSW	12	79238335	missense	probably damaging	1.00
R6887:Zfyve26	UTSW	12	79266449	missense	probably damaging	1.00
R7133:Zfyve26	UTSW	12	79284152	missense	probably benign	0.06
R7152:Zfyve26	UTSW	12	79279114	missense	probably benign	0.42
R7165:Zfyve26	UTSW	12	79280405	missense	probably damaging	1.00
R7181:Zfyve26	UTSW	12	79268408	missense	probably benign	0.00
R7223:Zfyve26	UTSW	12	79246171	missense	probably damaging	0.99
R7296:Zfyve26	UTSW	12	79278372	intron	probably null
R7299:Zfyve26	UTSW	12	79282984	missense	probably benign	0.01
R7301:Zfyve26	UTSW	12	79282984	missense	probably benign	0.01
R7302:Zfyve26	UTSW	12	79251168	missense	probably damaging	1.00
R7355:Zfyve26	UTSW	12	79240054	missense	probably damaging	1.00
R7466:Zfyve26	UTSW	12	79287807	missense	probably benign	0.00
R7540:Zfyve26	UTSW	12	79268676	missense	probably damaging	0.99
R7552:Zfyve26	UTSW	12	79290957	missense	probably damaging	0.97
R7762:Zfyve26	UTSW	12	79268635	missense	probably benign	0.02
R7806:Zfyve26	UTSW	12	79280355	critical splice donor site	probably null
R7821:Zfyve26	UTSW	12	79255324	missense	probably damaging	1.00
RF010:Zfyve26	UTSW	12	79255338	missense	probably damaging	1.00
X0020:Zfyve26	UTSW	12	79239005	missense	probably damaging	1.00
Z1176:Zfyve26	UTSW	12	79268533	missense	not run
Z1177:Zfyve26	UTSW	12	79287375	missense	not run

Predicted Primers

PCR Primer
(F):5'- TGCAATGCCTCTCGGATGAG -3'
(R):5'- AGCATACATTTTGGGGAAAGTG -3'

Sequencing Primer
(F):5'- GGATGAGGTCCAGCAGGG -3'
(R):5'- ACTTGGGTAACTGGGCTAATCAC -3'

Posted On

2016-05-10