Incidental Mutation 'R4990:Nrxn3'
ID386152
Institutional Source Beutler Lab
Gene Symbol Nrxn3
Ensembl Gene ENSMUSG00000066392
Gene Nameneurexin III
Synonyms4933401A11Rik, 9330112C09Rik, D12Bwg0831e, neurexin III alpha, neurexin III beta, neurexin III alpha, neurexin III beta
MMRRC Submission 042584-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4990 (G1)
Quality Score221
Status Not validated
Chromosome12
Chromosomal Location88722876-90334935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89260474 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 293 (I293N)
Ref Sequence ENSEMBL: ENSMUSP00000127926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057634] [ENSMUST00000163134] [ENSMUST00000167103] [ENSMUST00000167887] [ENSMUST00000190626]
Predicted Effect probably damaging
Transcript: ENSMUST00000057634
AA Change: I293N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000050075
Gene: ENSMUSG00000066392
AA Change: I293N

DomainStartEndE-ValueType
LamG 94 246 3.28e-41 SMART
EGF 273 307 4.1e-2 SMART
LamG 332 470 4.87e-26 SMART
LamG 518 654 7.08e-37 SMART
EGF 688 722 1.99e1 SMART
LamG 750 907 1.14e-17 SMART
low complexity region 948 964 N/A INTRINSIC
low complexity region 1028 1043 N/A INTRINSIC
4.1m 1046 1064 4.38e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163134
AA Change: I666N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129678
Gene: ENSMUSG00000066392
AA Change: I666N

DomainStartEndE-ValueType
LamG 47 184 9.8e-31 SMART
EGF 201 235 8.07e-1 SMART
LamG 279 413 7.19e-38 SMART
LamG 467 619 3.28e-41 SMART
EGF 646 680 4.1e-2 SMART
LamG 705 843 4.87e-26 SMART
LamG 891 1027 7.08e-37 SMART
EGF 1052 1086 1.99e1 SMART
LamG 1114 1271 1.14e-17 SMART
low complexity region 1312 1328 N/A INTRINSIC
low complexity region 1395 1406 N/A INTRINSIC
low complexity region 1499 1514 N/A INTRINSIC
4.1m 1517 1535 4.38e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167103
AA Change: I666N

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127407
Gene: ENSMUSG00000066392
AA Change: I666N

DomainStartEndE-ValueType
LamG 47 184 9.8e-31 SMART
EGF 201 235 8.07e-1 SMART
LamG 279 413 7.19e-38 SMART
LamG 467 619 3.28e-41 SMART
EGF 646 680 4.1e-2 SMART
LamG 705 834 5.76e-28 SMART
LamG 882 1018 7.08e-37 SMART
EGF 1043 1077 1.99e1 SMART
LamG 1105 1262 1.14e-17 SMART
low complexity region 1303 1319 N/A INTRINSIC
low complexity region 1354 1382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167734
Predicted Effect probably damaging
Transcript: ENSMUST00000167887
AA Change: I293N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127926
Gene: ENSMUSG00000066392
AA Change: I293N

DomainStartEndE-ValueType
LamG 94 246 3.28e-41 SMART
EGF 273 307 4.1e-2 SMART
LamG 332 470 4.87e-26 SMART
LamG 518 654 7.08e-37 SMART
EGF 688 722 1.99e1 SMART
LamG 750 907 1.14e-17 SMART
low complexity region 948 964 N/A INTRINSIC
low complexity region 1028 1043 N/A INTRINSIC
4.1m 1046 1064 4.38e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190626
AA Change: I293N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139879
Gene: ENSMUSG00000066392
AA Change: I293N

DomainStartEndE-ValueType
LamG 94 246 2.1e-43 SMART
EGF 273 307 2e-4 SMART
LamG 332 470 3.1e-28 SMART
LamG 518 654 4.4e-39 SMART
EGF 688 722 9.6e-2 SMART
LamG 750 877 1.1e-22 SMART
low complexity region 918 934 N/A INTRINSIC
low complexity region 972 1000 N/A INTRINSIC
Meta Mutation Damage Score 0.5737 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a family of proteins that function in the nervous system as receptors and cell adhesion molecules. Extensive alternative splicing and the use of alternative promoters results in multiple transcript variants for this gene, but the full-length nature of many of these variants has not been determined. Transcripts that initiate from an upstream promoter encode alpha isoforms, which contain epidermal growth factor-like (EGF-like) sequences and laminin G domains. Transcripts initiating from the downstream promoter encode beta isoforms, which lack EGF-like sequences. [provided by RefSeq, Dec 2012]
PHENOTYPE: Twenty percent of mice homozygous for a knock-out allele die postnatally prior to 20 days of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,294,939 I1135V possibly damaging Het
Abca14 G A 7: 120,312,165 R1324K probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Aplnr G A 2: 85,137,377 V249M probably damaging Het
Atg16l1 A G 1: 87,789,369 K471R probably benign Het
Cacna1b A G 2: 24,678,874 probably null Het
Ccdc152 A G 15: 3,301,157 I12T probably benign Het
Cds1 A G 5: 101,798,379 Y148C probably damaging Het
Cenpe T A 3: 135,256,640 L1989Q probably damaging Het
Cep295 T C 9: 15,332,138 Q1674R probably damaging Het
D930020B18Rik C G 10: 121,654,761 P89A probably damaging Het
D930020B18Rik C T 10: 121,654,762 P89L probably damaging Het
Dock2 T C 11: 34,695,251 M535V probably damaging Het
Dscam A G 16: 96,825,515 V398A probably benign Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Emb T A 13: 117,264,510 N198K probably damaging Het
Eno3 A G 11: 70,658,647 D98G probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Fbxw18 T C 9: 109,688,393 E414G probably damaging Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm5861 A T 5: 11,186,414 E138V probably damaging Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Hnrnpr A G 4: 136,329,379 E230G probably damaging Het
Hnrnpr G A 4: 136,336,298 V239I probably damaging Het
Ipo11 A T 13: 106,860,887 I688K probably benign Het
Irx4 G T 13: 73,265,507 R32L probably benign Het
Kcnh7 T C 2: 62,734,288 N876D probably benign Het
Klk1b26 T A 7: 44,016,249 probably null Het
Lrp2 G T 2: 69,481,388 T2582K probably benign Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Megf6 A G 4: 154,267,226 E1132G possibly damaging Het
Mesp1 A G 7: 79,792,921 Y203H probably damaging Het
Ms4a4a T C 19: 11,378,837 S29P probably benign Het
Nbeal2 A C 9: 110,634,803 C1174G probably benign Het
Neb C T 2: 52,255,546 V2989I probably benign Het
Nkx2-1 T C 12: 56,534,939 Y41C possibly damaging Het
Nt5e A G 9: 88,355,593 N192S probably benign Het
Ntng1 A T 3: 110,135,261 probably null Het
Olfr1215 A T 2: 89,001,472 I272K probably damaging Het
Olfr1229 A T 2: 89,283,327 probably null Het
Olfr411 A G 11: 74,347,197 I129T probably damaging Het
Olfr45 G A 7: 140,691,447 E181K probably damaging Het
Panx1 A G 9: 15,010,217 Y121H probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Pgm3 T A 9: 86,558,412 I409F probably damaging Het
Plg T C 17: 12,411,510 Y645H probably benign Het
Pon3 T C 6: 5,221,619 H337R probably benign Het
Rasa2 A G 9: 96,591,989 I162T probably benign Het
Ror1 A G 4: 100,441,964 I845V probably benign Het
Rpl4 T C 9: 64,174,885 V22A probably benign Het
Ryr3 G T 2: 112,635,777 Q4746K probably damaging Het
Ryr3 T C 2: 112,909,973 N531S probably damaging Het
Sbno1 A T 5: 124,400,165 F571I probably damaging Het
Scarf1 T C 11: 75,526,015 V761A probably benign Het
Sec22b T G 3: 97,921,111 probably null Het
Slc45a2 A G 15: 11,001,150 M112V probably benign Het
Snai3 G A 8: 122,456,332 T158M possibly damaging Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Trappc11 A T 8: 47,490,895 D1127E probably benign Het
Triobp C A 15: 78,967,005 A453D probably benign Het
Tubd1 T C 11: 86,557,839 L295P probably damaging Het
Ulk4 C T 9: 121,192,786 V620I probably benign Het
Vmn2r39 A G 7: 9,023,676 I442T probably benign Het
Wwc1 T C 11: 35,876,566 T413A probably benign Het
Zfp131 A C 13: 119,782,913 V77G probably damaging Het
Zfyve26 T C 12: 79,287,833 D137G probably damaging Het
Other mutations in Nrxn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Nrxn3 APN 12 90204592 missense probably damaging 1.00
IGL00961:Nrxn3 APN 12 90204546 missense possibly damaging 0.95
IGL01073:Nrxn3 APN 12 89254740 missense probably benign 0.25
IGL01338:Nrxn3 APN 12 89255034 missense possibly damaging 0.86
IGL01377:Nrxn3 APN 12 89533012 critical splice donor site probably null
IGL01409:Nrxn3 APN 12 89510358 missense probably damaging 1.00
IGL01764:Nrxn3 APN 12 90204750 missense possibly damaging 0.48
IGL02063:Nrxn3 APN 12 88795795 missense possibly damaging 0.86
IGL02171:Nrxn3 APN 12 89193163 missense probably damaging 1.00
IGL02309:Nrxn3 APN 12 89976407 missense probably damaging 0.99
IGL02340:Nrxn3 APN 12 90204628 missense possibly damaging 0.82
IGL02343:Nrxn3 APN 12 88795353 missense probably damaging 1.00
IGL02600:Nrxn3 APN 12 89511912 splice site probably benign
IGL02735:Nrxn3 APN 12 89254854 missense probably benign 0.16
IGL03061:Nrxn3 APN 12 89511928 nonsense probably null
IGL03206:Nrxn3 APN 12 89260508 missense possibly damaging 0.88
IGL03337:Nrxn3 APN 12 89255020 missense probably damaging 1.00
R0098:Nrxn3 UTSW 12 89260201 missense probably damaging 1.00
R0098:Nrxn3 UTSW 12 89260201 missense probably damaging 1.00
R0144:Nrxn3 UTSW 12 89348392 missense probably damaging 1.00
R0334:Nrxn3 UTSW 12 89813642 critical splice donor site probably null
R0531:Nrxn3 UTSW 12 88795342 missense probably damaging 1.00
R0840:Nrxn3 UTSW 12 90331793 missense possibly damaging 0.68
R1324:Nrxn3 UTSW 12 89254696 missense possibly damaging 0.89
R1438:Nrxn3 UTSW 12 90332135 missense probably damaging 1.00
R1484:Nrxn3 UTSW 12 89254777 missense probably damaging 0.99
R1621:Nrxn3 UTSW 12 88795710 missense probably benign
R1637:Nrxn3 UTSW 12 89354468 missense possibly damaging 0.94
R1659:Nrxn3 UTSW 12 90332391 missense probably damaging 1.00
R1746:Nrxn3 UTSW 12 89255019 missense possibly damaging 0.63
R1801:Nrxn3 UTSW 12 90283582 missense probably damaging 1.00
R1912:Nrxn3 UTSW 12 88795342 missense probably damaging 1.00
R1940:Nrxn3 UTSW 12 89260381 missense probably damaging 0.98
R1993:Nrxn3 UTSW 12 89260411 missense possibly damaging 0.59
R2002:Nrxn3 UTSW 12 90332315 missense probably damaging 1.00
R2125:Nrxn3 UTSW 12 89260520 splice site probably null
R2179:Nrxn3 UTSW 12 89254678 missense probably damaging 1.00
R2207:Nrxn3 UTSW 12 89348312 missense probably damaging 1.00
R2284:Nrxn3 UTSW 12 89510365 missense probably damaging 1.00
R2433:Nrxn3 UTSW 12 89976392 missense probably damaging 1.00
R2969:Nrxn3 UTSW 12 89354471 missense probably damaging 1.00
R3053:Nrxn3 UTSW 12 89255101 missense probably damaging 0.99
R3076:Nrxn3 UTSW 12 89260416 missense probably damaging 1.00
R3078:Nrxn3 UTSW 12 89260416 missense probably damaging 1.00
R4033:Nrxn3 UTSW 12 89533001 missense probably damaging 1.00
R4222:Nrxn3 UTSW 12 89532992 nonsense probably null
R4321:Nrxn3 UTSW 12 90199231 missense probably damaging 1.00
R4470:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4471:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4472:Nrxn3 UTSW 12 90204741 missense probably damaging 1.00
R4686:Nrxn3 UTSW 12 89510651 missense probably damaging 0.99
R4776:Nrxn3 UTSW 12 90331956 missense possibly damaging 0.55
R4821:Nrxn3 UTSW 12 90204709 missense probably damaging 0.99
R4869:Nrxn3 UTSW 12 88795582 missense possibly damaging 0.95
R4910:Nrxn3 UTSW 12 89260360 missense possibly damaging 0.72
R4960:Nrxn3 UTSW 12 88795201 missense possibly damaging 0.79
R4991:Nrxn3 UTSW 12 89260474 missense probably damaging 1.00
R5057:Nrxn3 UTSW 12 89255034 missense probably damaging 0.99
R5329:Nrxn3 UTSW 12 89813584 missense possibly damaging 0.92
R5888:Nrxn3 UTSW 12 89512085 missense possibly damaging 0.91
R6249:Nrxn3 UTSW 12 89254678 missense probably damaging 1.00
R6264:Nrxn3 UTSW 12 90332237 missense probably damaging 1.00
R6373:Nrxn3 UTSW 12 89976469 missense probably damaging 1.00
R6401:Nrxn3 UTSW 12 89255000 missense possibly damaging 0.46
R6434:Nrxn3 UTSW 12 88795515 missense probably benign 0.32
R6528:Nrxn3 UTSW 12 89513049 missense probably damaging 1.00
R6612:Nrxn3 UTSW 12 89813332 intron probably benign
R6632:Nrxn3 UTSW 12 89193154 missense probably damaging 1.00
R6874:Nrxn3 UTSW 12 90332190 missense probably damaging 0.99
R7122:Nrxn3 UTSW 12 89510607 missense probably damaging 1.00
R7328:Nrxn3 UTSW 12 88795575 missense probably benign
R7352:Nrxn3 UTSW 12 88850293 missense probably benign
R7425:Nrxn3 UTSW 12 89513100 nonsense probably null
R7444:Nrxn3 UTSW 12 89510694 missense probably damaging 1.00
R7483:Nrxn3 UTSW 12 89510462 missense probably damaging 1.00
R7599:Nrxn3 UTSW 12 89512062 missense probably benign
R7738:Nrxn3 UTSW 12 88850304 missense possibly damaging 0.68
R7765:Nrxn3 UTSW 12 89813484 missense probably benign 0.03
X0019:Nrxn3 UTSW 12 90199221 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCCATGCTCAACTACGGTTAC -3'
(R):5'- ATGTGATCACGGGTATGCTTAG -3'

Sequencing Primer
(F):5'- TTACGTGGGCTGCATCCG -3'
(R):5'- TTCACAACTAGAAAGGATGAGTTCC -3'
Posted On2016-05-10