Incidental Mutation 'R4990:Elmo1'
ID386153
Institutional Source Beutler Lab
Gene Symbol Elmo1
Ensembl Gene ENSMUSG00000041112
Gene Nameengulfment and cell motility 1
SynonymsC230095H21Rik, 6330578D22Rik, CED-12
MMRRC Submission 042584-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4990 (G1)
Quality Score179
Status Not validated
Chromosome13
Chromosomal Location20090596-20608353 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20342519 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 413 (F413S)
Ref Sequence ENSEMBL: ENSMUSP00000152595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072519] [ENSMUST00000180626]
Predicted Effect probably benign
Transcript: ENSMUST00000072519
SMART Domains Protein: ENSMUSP00000072334
Gene: ENSMUSG00000041112

DomainStartEndE-ValueType
Pfam:DUF3361 115 280 3.8e-64 PFAM
Pfam:ELMO_CED12 303 481 2.8e-42 PFAM
PH 555 676 2.32e0 SMART
low complexity region 704 717 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000180626
AA Change: F413S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000221595
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the engulfment and cell motility protein family. These proteins interact with dedicator of cytokinesis proteins to promote phagocytosis and cell migration. Increased expression of this gene and dedicator of cytokinesis 1 may promote glioma cell invasion, and single nucleotide polymorphisms in this gene may be associated with diabetic nephropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired Sertoli cell phagocytosis of apoptotic male germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,294,939 I1135V possibly damaging Het
Abca14 G A 7: 120,312,165 R1324K probably benign Het
Amer3 A C 1: 34,588,741 D687A probably benign Het
Aplnr G A 2: 85,137,377 V249M probably damaging Het
Atg16l1 A G 1: 87,789,369 K471R probably benign Het
Cacna1b A G 2: 24,678,874 probably null Het
Ccdc152 A G 15: 3,301,157 I12T probably benign Het
Cds1 A G 5: 101,798,379 Y148C probably damaging Het
Cenpe T A 3: 135,256,640 L1989Q probably damaging Het
Cep295 T C 9: 15,332,138 Q1674R probably damaging Het
D930020B18Rik C G 10: 121,654,761 P89A probably damaging Het
D930020B18Rik C T 10: 121,654,762 P89L probably damaging Het
Dock2 T C 11: 34,695,251 M535V probably damaging Het
Dscam A G 16: 96,825,515 V398A probably benign Het
Emb T A 13: 117,264,510 N198K probably damaging Het
Eno3 A G 11: 70,658,647 D98G probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Fbxw18 T C 9: 109,688,393 E414G probably damaging Het
Gm16432 A C 1: 178,098,421 I218L probably benign Het
Gm5861 A T 5: 11,186,414 E138V probably damaging Het
Grem2 A G 1: 174,836,813 C157R probably damaging Het
Hnrnpr A G 4: 136,329,379 E230G probably damaging Het
Hnrnpr G A 4: 136,336,298 V239I probably damaging Het
Ipo11 A T 13: 106,860,887 I688K probably benign Het
Irx4 G T 13: 73,265,507 R32L probably benign Het
Kcnh7 T C 2: 62,734,288 N876D probably benign Het
Klk1b26 T A 7: 44,016,249 probably null Het
Lrp2 G T 2: 69,481,388 T2582K probably benign Het
Lrriq1 A G 10: 103,200,559 I911T probably damaging Het
Megf6 A G 4: 154,267,226 E1132G possibly damaging Het
Mesp1 A G 7: 79,792,921 Y203H probably damaging Het
Ms4a4a T C 19: 11,378,837 S29P probably benign Het
Nbeal2 A C 9: 110,634,803 C1174G probably benign Het
Neb C T 2: 52,255,546 V2989I probably benign Het
Nkx2-1 T C 12: 56,534,939 Y41C possibly damaging Het
Nrxn3 T A 12: 89,260,474 I293N probably damaging Het
Nt5e A G 9: 88,355,593 N192S probably benign Het
Ntng1 A T 3: 110,135,261 probably null Het
Olfr1215 A T 2: 89,001,472 I272K probably damaging Het
Olfr1229 A T 2: 89,283,327 probably null Het
Olfr411 A G 11: 74,347,197 I129T probably damaging Het
Olfr45 G A 7: 140,691,447 E181K probably damaging Het
Panx1 A G 9: 15,010,217 Y121H probably damaging Het
Pcsk4 A G 10: 80,325,381 I233T possibly damaging Het
Pgm3 T A 9: 86,558,412 I409F probably damaging Het
Plg T C 17: 12,411,510 Y645H probably benign Het
Pon3 T C 6: 5,221,619 H337R probably benign Het
Rasa2 A G 9: 96,591,989 I162T probably benign Het
Ror1 A G 4: 100,441,964 I845V probably benign Het
Rpl4 T C 9: 64,174,885 V22A probably benign Het
Ryr3 G T 2: 112,635,777 Q4746K probably damaging Het
Ryr3 T C 2: 112,909,973 N531S probably damaging Het
Sbno1 A T 5: 124,400,165 F571I probably damaging Het
Scarf1 T C 11: 75,526,015 V761A probably benign Het
Sec22b T G 3: 97,921,111 probably null Het
Slc45a2 A G 15: 11,001,150 M112V probably benign Het
Snai3 G A 8: 122,456,332 T158M possibly damaging Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
Sv2b T C 7: 75,117,722 N642S possibly damaging Het
Svil T A 18: 5,056,810 I561K probably benign Het
Trappc11 A T 8: 47,490,895 D1127E probably benign Het
Triobp C A 15: 78,967,005 A453D probably benign Het
Tubd1 T C 11: 86,557,839 L295P probably damaging Het
Ulk4 C T 9: 121,192,786 V620I probably benign Het
Vmn2r39 A G 7: 9,023,676 I442T probably benign Het
Wwc1 T C 11: 35,876,566 T413A probably benign Het
Zfp131 A C 13: 119,782,913 V77G probably damaging Het
Zfyve26 T C 12: 79,287,833 D137G probably damaging Het
Other mutations in Elmo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00548:Elmo1 APN 13 20261579 missense probably benign
IGL00814:Elmo1 APN 13 20286724 missense probably damaging 0.97
IGL00849:Elmo1 APN 13 20582323 nonsense probably null
IGL01417:Elmo1 APN 13 20251175 critical splice donor site probably null
IGL01994:Elmo1 APN 13 20342464 missense probably damaging 0.99
IGL02435:Elmo1 APN 13 20589656 missense probably damaging 1.00
IGL02605:Elmo1 APN 13 20605202 missense probably damaging 1.00
IGL02716:Elmo1 APN 13 20449502 missense probably damaging 0.98
IGL03389:Elmo1 APN 13 20342426 missense probably damaging 0.98
Debil UTSW 13 20373161 missense probably damaging 1.00
Dollie UTSW 13 20572446 missense possibly damaging 0.91
Edinburg UTSW 13 20290383 nonsense probably null
Golly UTSW 13 20373116 missense possibly damaging 0.96
sesame UTSW 13 20600212 nonsense probably null
H8562:Elmo1 UTSW 13 20280863 missense probably damaging 1.00
R0360:Elmo1 UTSW 13 20564493 nonsense probably null
R0364:Elmo1 UTSW 13 20564493 nonsense probably null
R0372:Elmo1 UTSW 13 20572459 critical splice donor site probably null
R0975:Elmo1 UTSW 13 20251137 missense probably damaging 0.98
R1167:Elmo1 UTSW 13 20185455 missense probably damaging 1.00
R1511:Elmo1 UTSW 13 20290477 missense possibly damaging 0.60
R1671:Elmo1 UTSW 13 20287884 splice site probably benign
R1677:Elmo1 UTSW 13 20589671 missense probably benign 0.22
R1868:Elmo1 UTSW 13 20589653 missense possibly damaging 0.78
R2941:Elmo1 UTSW 13 20600212 nonsense probably null
R3508:Elmo1 UTSW 13 20605232 missense probably damaging 1.00
R4344:Elmo1 UTSW 13 20261552 splice site probably null
R4378:Elmo1 UTSW 13 20373116 missense possibly damaging 0.96
R4423:Elmo1 UTSW 13 20600212 nonsense probably null
R4425:Elmo1 UTSW 13 20600212 nonsense probably null
R4516:Elmo1 UTSW 13 20282914 missense probably benign 0.11
R4862:Elmo1 UTSW 13 20449512 missense probably benign
R4991:Elmo1 UTSW 13 20342519 missense probably damaging 1.00
R4992:Elmo1 UTSW 13 20342519 missense probably damaging 1.00
R5197:Elmo1 UTSW 13 20564437 missense probably benign 0.20
R5269:Elmo1 UTSW 13 20449486 missense probably benign 0.00
R5386:Elmo1 UTSW 13 20600210 missense probably benign 0.01
R5471:Elmo1 UTSW 13 20572385 missense probably benign 0.01
R5922:Elmo1 UTSW 13 20605169 missense probably damaging 1.00
R5947:Elmo1 UTSW 13 20290383 nonsense probably null
R6512:Elmo1 UTSW 13 20373161 missense probably damaging 1.00
R6531:Elmo1 UTSW 13 20572446 missense possibly damaging 0.91
R7338:Elmo1 UTSW 13 20280812 missense probably benign 0.37
R7378:Elmo1 UTSW 13 20280935 missense probably benign 0.00
R7477:Elmo1 UTSW 13 20285319 missense
R7593:Elmo1 UTSW 13 20290440 missense probably benign
R7778:Elmo1 UTSW 13 20589642 critical splice acceptor site probably null
RF008:Elmo1 UTSW 13 20274536 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TGGAGCATTAATGGTGACCAC -3'
(R):5'- AAGGAACCTTGGCCTCTTTCC -3'

Sequencing Primer
(F):5'- GGAGCATTAATGGTGACCACATTTTC -3'
(R):5'- CAACCATGGAAGAAGTCTTGC -3'
Posted On2016-05-10